ctnnd2a

Ensembl ID:
ENSDARG00000062415
ZFIN ID:
ZDB-GENE-030616-60
Human Orthologue:
CTNND2
Human Description:
catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein) [Sour
Mouse Orthologue:
Ctnnd2
Mouse Description:
catenin (cadherin associated protein), delta 2 Gene [Source:MGI Symbol;Acc:MGI:1195966]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44137 Nonsense Mutation detected in F1 DNA During 2016
sa18233 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa44137
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066665 Nonsense 433 1221 7 21
ENSDART00000148197 Nonsense 391 1179 6 20

The following transcripts of ENSDARG00000062415 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 23003193)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 22250071
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAGGACAGAGTCTACCAGAAAGTCCCCATGAGGAGCCTAAGCCAGAGC[C/T]AGGGAGAAACCCTCCCTCCGGCCCATACAGGAACATACAGGAATAACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18233
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066665 Nonsense 1111 1221 20 21
ENSDART00000148197 Nonsense 1069 1179 19 20

The following transcripts of ENSDARG00000062415 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 22736001)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21982879
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAAAAAAAGTGTTCTCACACATTCTCACTCTGGCTTTCATCCCGCAGTT[C/T]AAACCTCCTGTGGAACATCCACATTGTTCCGGARTTCGTATGAGACTTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link