frem1b

Ensembl ID:
ENSDARG00000062402
ZFIN ID:
ZDB-GENE-050208-783
Description:
Fras-related extracellular matrix protein 1b [Source:RefSeq peptide;Acc:NP_001131130]
Human Orthologue:
FREM1
Human Description:
FRAS1 related extracellular matrix 1 [Source:HGNC Symbol;Acc:23399]
Mouse Orthologue:
Frem1
Mouse Description:
Fras1 related extracellular matrix protein 1 Gene [Source:MGI Symbol;Acc:MGI:2670972]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39367 Essential Splice Site Mutation detected in F1 DNA During 2016
sa37483 Nonsense Mutation detected in F1 DNA During 2016
sa10747 Nonsense Available for shipment Available now
sa17421 Essential Splice Site Available for shipment Available now
sa43806 Nonsense Mutation detected in F1 DNA During 2016
sa39368 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa39367
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090217 Essential Splice Site 110 2167 2 36
ENSDART00000135604 Essential Splice Site 110 2142 3 36
Genomic Location:
Chromosome 22 (position 17343178)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGGCAGTCCACTTCTTGAGGAAGACACCGTCATGTTGAGAGTCTACAG[G/A]TACAGTCTTTCACGGTCATTGTCATTCATGCAAACACACATTCAAGAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37483
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090217 Nonsense 185 2167 3 36
ENSDART00000135604 Nonsense 185 2142 4 36
Genomic Location:
Chromosome 22 (position 17346044)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGCACGCTTCGTCTTCTCAGCTCTGAGATCAGTGTTCCAGCACTGGGT[C/T]AGCTGGTGGTTGAGGAGTCTGGAACAATGGTGGACACTGAGGCTGGACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10747
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090217   None 2167 None 36
ENSDART00000135604 Nonsense 211 2142 4 36
Genomic Location:
Chromosome 22 (position 17346122)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTGGACACTGAGGCTGGACCAAGAAAAGGTATTACAGAGTGCATAATR[A/T]AGCTTTTTTTGTCAGATCAATGTCTATGGGGTGCAACTGACAAAGTTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17421
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090217 Essential Splice Site 279 2167 None 36
ENSDART00000135604 Essential Splice Site 274 2142 None 36
Genomic Location:
Chromosome 22 (position 17348059)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTCAGAATCATGTTCAAAGCACAACACTGAATGATCACCTTCTCTCCT[A/T]GACCGAGAGTGTCTGGTTACCGGTATTGAWCCAGGGGGMGATGCAGAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43806
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090217 Nonsense 1242 2167 20 36
ENSDART00000135604 Nonsense 1217 2142 20 36
Genomic Location:
Chromosome 22 (position 17373748)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGTCTTGAGATGAATCGTTACAAAAGCATGAACCCAGAGGTTCTCCAA[C/T]AAACCTTAGCAATCCAGTCCTTCACCTTGGAGGAGCTACAGCAAGGTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39368
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090217 Nonsense 1244 2167 20 36
ENSDART00000135604 Nonsense 1219 2142 20 36
Genomic Location:
Chromosome 22 (position 17373755)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGATGAATCGTTACAAAAGCATGAACCCAGAGGTTCTCCAACAAACCT[T/G]AGCAATCCAGTCCTTCACCTTGGAGGAGCTACAGCAAGGTCAGTTCTTAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Identification of 15 loci influencing height in a Korean population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link