frem1b

Ensembl ID:
ENSDARG00000062402
ZFIN ID:
ZDB-GENE-050208-783
Description:
Fras-related extracellular matrix protein 1b [Source:RefSeq peptide;Acc:NP_001131130]
Human Orthologue:
FREM1
Human Description:
FRAS1 related extracellular matrix 1 [Source:HGNC Symbol;Acc:23399]
Mouse Orthologue:
Frem1
Mouse Description:
Fras1 related extracellular matrix protein 1 Gene [Source:MGI Symbol;Acc:MGI:2670972]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10747 Nonsense Available for shipment Available now
sa17421 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10747
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090217 None None 2167 None 36
ENSDART00000135604 Nonsense 211 2142 4 36
Genomic Location:
Chromosome 22 (position 17346122)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTGGACACTGAGGCTGGACCAAGAAAAGGTATTACAGAGTGCATAATR[A/T]AGCTTTTTTTGTCAGATCAATGTCTATGGGGTGCAACTGACAAAGTTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17421
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090217 Essential Splice Site 279 2167 None 36
ENSDART00000135604 Essential Splice Site 274 2142 None 36
Genomic Location:
Chromosome 22 (position 17348059)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTCAGAATCATGTTCAAAGCACAACACTGAATGATCACCTTCTCTCCT[A/T]GACCGAGAGTGTCTGGTTACCGGTATTGAWCCAGGGGGMGATGCAGAACC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Identification of 15 loci influencing height in a Korean population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/62avxnq2