LOC100329944

Ensembl ID:
ENSDARG00000062397
Human Orthologue:
NDST1
Human Description:
N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1 [Source:HGNC Symbol;Acc:7680]
Mouse Orthologue:
Ndst1
Mouse Description:
N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1 Gene [Source:MGI Symbol;Acc:MGI:104719]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22412 Nonsense Mutation detected in F1 DNA During 2014
sa4546 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22412
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090213 Nonsense 111 869 1 16
Genomic Location:
Chromosome 14 (position 3164562)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCTGGGACAGGAGATTGTGGCCATCCTGGAGTCGGCTCGGTTCCGCTA[T/A]CGGACAGAGATTTCGCCGGGGAAAGGGGACATGCCTACTTTGATGGAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4546
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090213 Nonsense 577 869 9 16
Genomic Location:
Chromosome 14 (position 3175227)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCNAATGAAGATATGTGTGATGTTATCTTTAGGACCCTTGTGAGGATAAA[C/T]GACACARGGACATCTGGTCCAAAGAGAAGACCTGCGATCGCTTCCCAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/r81vxkpj