anks1a

Ensembl ID:
ENSDARG00000062396
ZFIN ID:
ZDB-GENE-090312-152
Human Orthologue:
ANKS1A
Human Description:
ankyrin repeat and sterile alpha motif domain containing 1A [Source:HGNC Symbol;Acc:20961]
Mouse Orthologue:
Anks1
Mouse Description:
ankyrin repeat and SAM domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2446180]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24229 Nonsense Mutation detected in F1 DNA During 2016
sa37578 Nonsense Mutation detected in F1 DNA During 2016
sa10185 Nonsense Available for shipment Available now
sa43895 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa24229
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092886 Nonsense 129 318 4 8
ENSDART00000143125   None 139 None 3
Genomic Location (Zv9):
Chromosome 23 (position 283747)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 254738
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTTTGTAAAAGCAGCTGAAATGTGTGTGTTTCTGTCTGTCCTGCAGTA[T/A]CTGGGCTCGATGCTCATTAAAGAGCTCAGAGGAACGGAGTCGACGCAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37578
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092886 Nonsense 239 318 7 8
ENSDART00000143125   None 139 None 3
Genomic Location (Zv9):
Chromosome 23 (position 280931)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 251922
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCGCCTCCCGGACAGAACCTGACCTATGAGATCATCCTGACGCTGGGA[C/T]AGGCGTTTGAAGTGGCCTATCAGCTGGCACTGCAGGCCCAGAGGAGCCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10185
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092886 Nonsense 245 318 7 8
ENSDART00000143125   None 139 None 3
Genomic Location (Zv9):
Chromosome 23 (position 280911)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 251902
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGACCTAWGAGATCATCCTGACGCTGGGACAGGCGTTTGAAGTGGCCTA[T/A]CAGCTGGCACTGCAGGCCCAGAGGAGCCGCCAGCAGCAGAGCTCAGCCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43895
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092886 Essential Splice Site 286 318 7 8
ENSDART00000143125   None 139 None 3
Genomic Location (Zv9):
Chromosome 23 (position 280786)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 251777
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCAGCAGACCCGTCCCCAAACCACGGGCCAGCATGCGCAAGTCTGGGG[T/C]CAGAACACACACACACACACACACACACACACACACATGCACACACACAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link