flcn

Ensembl ID:
ENSDARG00000062385
ZFIN ID:
ZDB-GENE-060421-3470
Description:
folliculin [Source:RefSeq peptide;Acc:NP_001035463]
Human Orthologue:
FLCN
Human Description:
folliculin [Source:HGNC Symbol;Acc:27310]
Mouse Orthologue:
Flcn
Mouse Description:
folliculin Gene [Source:MGI Symbol;Acc:MGI:2442184]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
e36 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
e36
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090191 Nonsense 12 558 2 12
ENSDART00000135245 Nonsense 12 194 2 4
Genomic Location:
Chromosome 16 (position 15573871)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTTTGTTTCCTCCAGATGAACGCTTTAGTTGCCCTGTGCCACTTTTGT[G/T]AGCTCCATGGCCCACGGACGCTGTTTTGTACCGAAGCCGTCCACCCTCCG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wnpw9nru