si:ch211-238n5.4

Ensembl ID:
ENSDARG00000062381
ZFIN ID:
ZDB-GENE-050419-80
Description:
Protein LCHN [Source:UniProtKB/Swiss-Prot;Acc:Q1LX49]
Human Orthologue:
KIAA1147
Human Description:
KIAA1147 [Source:HGNC Symbol;Acc:29472]
Mouse Orthologue:
E330009J07Rik
Mouse Description:
RIKEN cDNA E330009J07 gene Gene [Source:MGI Symbol;Acc:MGI:2444256]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43090 Nonsense Mutation detected in F1 DNA During 2017
sa32203 Nonsense Available for shipment Available now
sa16749 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa43090
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077076 Nonsense 53 410 1 9
ENSDART00000090186 Nonsense 53 493 1 11
ENSDART00000141367 Nonsense 53 490 1 9
Genomic Location (Zv9):
Chromosome 18 (position 20340365)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 20570588
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGGCTATCAAGTTACCCAACTGAGGCCACATTAGGGGCAGATATCACCT[T/A]GAACACGAGCCCGACGAGACCGAGCAGTGTAGCAGCTGTTCATTCTCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32203
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077076 Nonsense 366 410 7 9
ENSDART00000090186 Nonsense 366 493 7 11
ENSDART00000141367 Nonsense 366 490 7 9
Genomic Location (Zv9):
Chromosome 18 (position 20325660)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 20555883
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTTCTCAGGTACCACAGAGAAGATCTTTGAGGAAAAGAAGGAGCTGTA[T/A]GATGTGTACATTGACAATCAGAACGTGAAGACGCACAGAGAGAGTCTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16749
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077076   None 410 None 9
ENSDART00000090186 Essential Splice Site None 493 10 11
ENSDART00000141367   None 490 None 9
Genomic Location (Zv9):
Chromosome 18 (position 20323876)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 20554099
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCTGACCCCTCTGGACCACACTGATACTGCCAACACCAACAACCCAAG[T/A]CCGTCTACAGGCTTTTTCGCGCAGCCAGTGGCGTCTTTCTGCTTCTCTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link