nlgn3b

Ensembl ID:
ENSDARG00000062376
ZFIN ID:
ZDB-GENE-060526-197
Description:
neuroligin 3b [Source:RefSeq peptide;Acc:NP_001159806]
Human Orthologue:
NLGN3
Human Description:
neuroligin 3 [Source:HGNC Symbol;Acc:14289]
Mouse Orthologue:
Nlgn3
Mouse Description:
neuroligin 3 Gene [Source:MGI Symbol;Acc:MGI:2444609]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20395 Nonsense Available for shipment Available now
sa40413 Nonsense Mutation detected in F1 DNA During 2017
sa17458 Nonsense Available for shipment Available now
sa1317 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20395
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090171 Nonsense 112 846 1 7
Genomic Location (Zv9):
Chromosome 5 (position 24985864)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 22813129
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCCTGGTCTGGTGTGAGGAACGCCACGCGCTTTCCTCCTGTTTGCCCA[C/T]AGACCGTTCGCAACGCAGTGCCAGACATAATGATGCCCGTTTGGGCCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40413
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090171 Nonsense 428 846 6 7
Genomic Location (Zv9):
Chromosome 5 (position 24957417)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 22784682
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCGATTTTGACTTCACTGTGTCTGACTTTGTGGACAGTCTCTATGGTTA[T/A]CCAGAAGGGAAGGACACTCTTAGAGAGACCATAAAGTTTATGTACACTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17458
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090171 Nonsense 514 846 6 7
Genomic Location (Zv9):
Chromosome 5 (position 24957159)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 22784424
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCATGAAGCCCCCATGGGCTGACTCCGCACATGGTGAYGAGCTGCCCTA[C/A]GTTTTTGGTGTTCCGCTTATCGGTCCGACAGAACTCTTTCCCTGCAACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1317
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090171 Nonsense 601 846 7 7
Genomic Location (Zv9):
Chromosome 5 (position 24955245)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 22782510
KASP Assay ID:
554-1231.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACCAACTCTACCTGCACATTGGGCTGAAGCCTCGCGTTCGAGATCACTA[T/A]CGGGCAACTAAAGTGGCCTTCTGGAAGCAYCTGGTACCTCACCTGTACAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link