nrd1

Ensembl ID:
ENSDARG00000062372
ZFIN ID:
ZDB-GENE-050208-422
Description:
nardilysin [Source:RefSeq peptide;Acc:NP_001038180]
Human Orthologue:
NRD1
Human Description:
nardilysin (N-arginine dibasic convertase) [Source:HGNC Symbol;Acc:7995]
Mouse Orthologue:
Nrd1
Mouse Description:
nardilysin, N-arginine dibasic convertase, NRD convertase 1 Gene [Source:MGI Symbol;Acc:MGI:1201386]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3171 Nonsense Available for shipment Available now
sa37484 Essential Splice Site Mutation detected in F1 DNA During 2017
sa15340 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa3171
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090107 Nonsense 200 1061 6 31
ENSDART00000126094 Nonsense 157 1017 5 30
ENSDART00000129109 Nonsense 200 618 6 31
Genomic Location (Zv9):
Chromosome 22 (position 17439986)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17191744
KASP Assay ID:
554-2869.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATCGTGCACTTGCATTATTTGTCCACAGATGGGCGCAGTTTTTCATCTG[T/A]CCTTTGATGATTCCTGATGCTGTAGACAGAGAGGTGGAGGCTGTAGACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37484
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090107 Essential Splice Site 218 1061 6 31
ENSDART00000126094 Essential Splice Site 175 1017 5 30
ENSDART00000129109 Essential Splice Site 218 618 6 31
Genomic Location (Zv9):
Chromosome 22 (position 17440040)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17191798
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGATGATTCCTGATGCTGTAGACAGAGAGGTGGAGGCTGTAGACAGCGG[T/G]CAGTCAATGCTTTAATAACATTTCCTTTAAATAAAAAAGTTTATTTGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15340
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090107 Essential Splice Site 787 1061 None 31
ENSDART00000126094 Essential Splice Site 743 1017 None 30
ENSDART00000129109 Essential Splice Site None 618 None 31
Genomic Location (Zv9):
Chromosome 22 (position 17453373)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17205131
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATTTCTGCTCAAACAGGAGTCCAAAGAGTTTCTGCAGTGTTTTATTGAG[T/C]AAGTTTGCAGATTTCTATAATTGTTAGCAATTAGAGTAAGATAAATAKAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link