bcl2l13

Ensembl ID:
ENSDARG00000062370
ZFIN ID:
ZDB-GENE-050419-215
Description:
bcl-2-like protein 13 [Source:RefSeq peptide;Acc:NP_001038356]
Human Orthologue:
BCL2L13
Human Description:
BCL2-like 13 (apoptosis facilitator) [Source:HGNC Symbol;Acc:17164]
Mouse Orthologue:
Bcl2l13
Mouse Description:
BCL2-like 13 (apoptosis facilitator) Gene [Source:MGI Symbol;Acc:MGI:2136959]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10792 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10792
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090156 Nonsense 130 485 5 7
ENSDART00000129290 Nonsense 130 485 4 6
ENSDART00000140632 Nonsense 130 485 5 7

The following transcripts of ENSDARG00000062370 do not overlap with this mutation:

Genomic Location:
Chromosome 18 (position 20379221)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGAGAAATGTCCTAAGTGGTGATTTTNGTATGTGTCTCATGCAGTGACT[T/A]GAACTTYGAATGCTTCAGAGCAGCAGTGGACGAGGTTTCCTCTCACGCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pwk2pxyc