si:dkey-125i10.5

Ensembl ID:
ENSDARG00000062362
ZFIN ID:
ZDB-GENE-060526-199
Description:
Novel protein similar to vertebrate two pore segment channel 1 (TPCN1) [Source:UniProtKB/TrEMBL;Acc:
Human Orthologue:
TPCN1
Human Description:
two pore segment channel 1 [Source:HGNC Symbol;Acc:18182]
Mouse Orthologue:
Tpcn1
Mouse Description:
two pore channel 1 Gene [Source:MGI Symbol;Acc:MGI:2182472]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa135 Nonsense F2 line generated During 2017
sa31430 Nonsense Available for shipment Available now
sa33584 Nonsense Available for shipment Available now
sa20394 Nonsense Available for shipment Available now
sa31431 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa135
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090102 Nonsense 75 644 2 21
ENSDART00000138123 Nonsense 100 805 3 26
Genomic Location (Zv9):
Chromosome 5 (position 24881251)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 22708516
KASP Assay ID:
554-1448.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTGCCCATGCGCTCAGTGCCTACCTGTTTGCTCACAGTCATCTGTTCTA[T/A]GTGGTGGAGCTTCTGACTGCGGTGTTACTCATGCTCCTGTCCCTCTCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31430
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090102 Nonsense 336 644 9 21
ENSDART00000138123 Nonsense 361 805 10 26
Genomic Location (Zv9):
Chromosome 5 (position 24887660)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 22714925
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCCAGATGGCGTGTCTTTGAAACAGTTTGATGGACTGATGCGATTTTA[T/A]CATCCACGAATGACTCCACGTGATCGCTTTCTTACTTTTAAAGCCCTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33584
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090102 Nonsense 520 644 17 21
ENSDART00000138123 Nonsense 544 805 18 26
Genomic Location (Zv9):
Chromosome 5 (position 24892376)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 22719641
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATAATTTTTTTCATTTCTTATTAAGGTTATTTAAAATTAAACAGCGCTA[T/A]CGGAATGTTCTGGACACAATGTTTGAACTGTTCCCGCGCATGGCCAGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20394
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090102 Nonsense 576 644 19 21
ENSDART00000138123 Nonsense 600 805 20 26
Genomic Location (Zv9):
Chromosome 5 (position 24892770)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 22720035
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTATGATGTCTTTTCAATAGCAATAGCACCGTCGCGGCCTCCTATCGG[C/T]AGATAAATGTCACCACTGGCAACCGGACCGAATTACAAGAGGGATATTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31431
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090102 Nonsense 593 644 19 21
ENSDART00000138123 Nonsense 617 805 20 26
Genomic Location (Zv9):
Chromosome 5 (position 24892823)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 22720088
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAAATGTCACCACTGGCAACCGGACCGAATTACAAGAGGGATATTACTA[T/G]CTCAATAACTTCAATAACATCCTAAGCAGCTTTGGTATGTGCACACAGCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link