si:dkey-171o17.5

Ensembl ID:
ENSDARG00000062355
ZFIN ID:
ZDB-GENE-050208-341
Description:
hypothetical protein LOC557839 [Source:RefSeq peptide;Acc:NP_001082846]
Human Orthologue:
C1orf125
Human Description:
chromosome 1 open reading frame 125 [Source:HGNC Symbol;Acc:26564]
Mouse Orthologue:
9430070O13Rik
Mouse Description:
RIKEN cDNA 9430070O13 gene Gene [Source:MGI Symbol;Acc:MGI:1924602]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37485 Nonsense Available for shipment Available now
sa755 Nonsense Available for shipment Available now
sa10715 Nonsense Available for shipment Available now
sa18502 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa37485
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090069 Nonsense 247 1007 8 25
ENSDART00000136908   None 364 None 10
Genomic Location (Zv9):
Chromosome 22 (position 17463410)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17215168
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATGTATTTCTATATTATTTTTCAGATCGAAAATTTACTAGAGCTGATT[C/T]AAACTGAGCAGAACATCTACAATATAGTGTTTCATGAGGTAATCCGGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa755
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090069 Nonsense 291 1007 9 25
ENSDART00000136908   None 364 None 10
Genomic Location (Zv9):
Chromosome 22 (position 17467559)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17219317
KASP Assay ID:
554-0662.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTTTTCTTGGCTAGGCAAAAGTATGTGGCTCTACTTGACCGTATCCCA[C/T]GACAGGTGAAGGGTCTTCACACACAAACCTTAGCACAGAGGGCTCTGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10715
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090069 Nonsense 374 1007 11 25
ENSDART00000136908   None 364 None 10
Genomic Location (Zv9):
Chromosome 22 (position 17468227)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17219985
KASP Assay ID:
2261-6678.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACTTCTCATCAGTATTGTAGCAGAGTACCATGAACTCTATGAGCTACAG[C/T]GAAAGAGACTTGAAGGACAGATGTCCCATTTAGATGGCGAAAGGGACYTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18502
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090069 Essential Splice Site 923 1007 23 25
ENSDART00000136908 Essential Splice Site 280 364 8 10
Genomic Location (Zv9):
Chromosome 22 (position 17472343)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17224101
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGCCTTCAGTTCTTTAGAAACAATCAGAACYCTTCAGCAAGAGCTTCTG[T/G]AAGTATTCGAATGGAAATCTSTCTTTAGTCAGATCTATAGGAATCTCTTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link