si:ch211-69k21.4

Ensembl ID:
ENSDARG00000062347
ZFIN ID:
ZDB-GENE-091204-75
Human Orthologue:
MTUS2
Human Description:
microtubule associated tumor suppressor candidate 2 [Source:HGNC Symbol;Acc:20595]
Mouse Orthologue:
Mtus2
Mouse Description:
microtubule associated tumor suppressor candidate 2 Gene [Source:MGI Symbol;Acc:MGI:1915388]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11453 Nonsense Available for shipment Available now
sa9452 Essential Splice Site Available for shipment Available now
sa9606 Essential Splice Site Available for shipment Available now
sa34904 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa11453
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090059 Nonsense 282 1303 1 14
ENSDART00000141387   None 243 None 4
Genomic Location (Zv9):
Chromosome 10 (position 24996076)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 24595428
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCATAAAAGTGCATAAATTCCCAATGGAAGCGGAGSARAATACTGGATA[T/A]AAATGGATGTCAACTGAGGTGCCRAAAGGTATGGTGAGGGTACAACCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9452
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090059 Essential Splice Site 678 1303 2 14
ENSDART00000141387 Essential Splice Site 86 243 1 4
Genomic Location (Zv9):
Chromosome 10 (position 24997400)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 24596752
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCAATGCAGGCAGTTAACCCAACCACTCAAACTCCTCAGGAAACACAAG[G/A]TAAGATCTATCGCACAGTTCCATTTATATGGCATGTTTTACATCGCTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9606
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090059 Essential Splice Site 803 1303 None 14
ENSDART00000141387 Essential Splice Site 211 243 None 4
Genomic Location (Zv9):
Chromosome 10 (position 25036548)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 24635900
KASP Assay ID:
2260-3244.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCAGTTAATTCCCACACACTGCCATTAACTSTTGTCTTTCTTTCTCCGM[A/T]GTATCCCGTAAGGAATTCCAGAAGAGTTCGGATGGCTCCCGTTCATCCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34904
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090059 Nonsense 1059 1303 10 14
ENSDART00000141387   None 243 None 4
Genomic Location (Zv9):
Chromosome 10 (position 25048142)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 24647494
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGACAGAAATGGGGAGAAGAGCTCAATCTCATTTCGTTTATCTTAGATT[T/A]AAGGAAAGCCCATGAGCAGCAGAAAGCCAGTCTAGAAGAGGACTTCGAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link