cacna1r

Ensembl ID:
ENSDARG00000062346
ZFIN ID:
ZDB-GENE-081104-526
Description:
Novel protein similar to vertebrate calcium channel, voltage-dependent, R type, alpha 1E subunit (CA
Human Orthologue:
CACNA1E
Human Description:
calcium channel, voltage-dependent, R type, alpha 1E subunit [Source:HGNC Symbol;Acc:1392]
Mouse Orthologue:
Cacna1e
Mouse Description:
calcium channel, voltage-dependent, R type, alpha 1E subunit Gene [Source:MGI Symbol;Acc:MGI:106217]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9991 Nonsense Available for shipment Available now
sa946 Essential Splice Site F2 line generated During 2014
sa846 Essential Splice Site Available for shipment Available now
sa21228 Essential Splice Site Mutation detected in F1 DNA During 2014
sa16705 Nonsense Available for shipment Available now
sa21229 Nonsense Mutation detected in F1 DNA During 2014
sa17403 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9991
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089971 Nonsense 452 2318 9 47
ENSDART00000132899 Nonsense 376 741 8 18
ENSDART00000139972 None None 850 None 23
Genomic Location:
Chromosome 8 (position 15290076)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAGCGAGAGCGGGTAGAGAACCGGAGAGCCTTCATGAARCTTAGGAGA[C/T]AGCAGCAGATTGAGAGGGAGCTGAACGGATATCGGGCCTGGATCKACCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa946
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089971 Essential Splice Site 1221 2318 23 47
ENSDART00000132899 None None 741 None 18
ENSDART00000139972 Essential Splice Site 63 850 3 23
Genomic Location:
Chromosome 8 (position 15311599)
KASP Assay ID:
554-0851.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATGAATATGATCCCATTTCATCTCTCTTATTCTCTGTTCTCCCCTACA[G/T]GGTCCGCAGGGCCTGCCACTACGTTGTCAACCTTCGTTATTTTGAGATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa846
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089971 Essential Splice Site 1683 2318 34 47
ENSDART00000132899 None None 741 None 18
ENSDART00000139972 Essential Splice Site 525 850 14 23
Genomic Location:
Chromosome 8 (position 15325029)
KASP Assay ID:
554-0749.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGCTACACCATCCGTATTCTGCTCTGGACTTTTGTTCAGTCCTTCAAGG[T/G]CAGACATGTCTTGCGCTGCACTAGATTGAAATCCCTTATTCTTCTTTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21228
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089971 Essential Splice Site 1835 2318 38 47
ENSDART00000132899 None None 741 None 18
ENSDART00000139972 Essential Splice Site 677 850 18 23
Genomic Location:
Chromosome 8 (position 15327524)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTAGATGAGTTTGTACGGATCTGGGGAGAGTATGACCGTGCTGCATGG[T/A]AAGAGATGCAGCTTTATACCCTTTCTGTTTATGATGCATAATAAAAGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16705
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089971 Nonsense 1913 2318 41 47
ENSDART00000132899 None None 741 None 18
ENSDART00000139972 Nonsense 755 850 21 23
Genomic Location:
Chromosome 8 (position 15334730)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAATGAKCATTGTTTAATAGGAGGGGAAGACAGGGGTCAGATGGATGTT[G/T]AACTGCAGAAGGAAATCAGTGTCATCTGGCCGCATCTCTCACAGAAATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21229
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089971 Nonsense 1948 2318 42 47
ENSDART00000132899 None None 741 None 18
ENSDART00000139972 Nonsense 790 850 22 23
Genomic Location:
Chromosome 8 (position 15335280)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAAACAACTCTTTTTTCCAGCTAGTGACATGACCATTGGGAAGATCTA[T/A]GCAGCCATGATGATCATGGACTACTACAAGCAGAACAAAGCCAAGAAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17403
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089971 Nonsense 1985 2318 43 47
ENSDART00000132899 None None 741 None 18
ENSDART00000139972 Nonsense 827 850 23 23
Genomic Location:
Chromosome 8 (position 15335659)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTGWCTTGCAGAAWCACGCACCAATGTTCCAACGCATGGATGCATCCT[C/A]GCTGCCGCAGGAMATCCTCTGCAGTGCCAAGGCTTTGCCATTCCTGACYC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wc8fm31j