LOC556331

Ensembl ID:
ENSDARG00000062343
Human Orthologue:
NETO2
Human Description:
neuropilin (NRP) and tolloid (TLL)-like 2 [Source:HGNC Symbol;Acc:14644]
Mouse Orthologue:
Neto2
Mouse Description:
neuropilin (NRP) and tolloid (TLL)-like 2 Gene [Source:MGI Symbol;Acc:MGI:1921763]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14767 Nonsense Available for shipment Available now
sa43852 Essential Splice Site Mutation detected in F1 DNA During 2016
sa13616 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14767
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090043 Nonsense 62 534 2 8
Genomic Location:
Chromosome 22 (position 25096047)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCCARTGGACCCGAAATATCAATGGAGGGCTWTTCACATCTCCGAACTA[T/A]CCAAACTCATATCCACCCAAYAAGGAGTGTGTGWACATCCTAGAAGGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43852
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090043 Essential Splice Site 77 534 2 8
Genomic Location:
Chromosome 22 (position 25096094)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTATCCAAACTCATATCCACCCAACAAGGAGTGTGTGTACATCCTAGAAG[G/A]TAACCTCGCTAACAGCAAAAGAAAGATGTGTCTCCGGCTATTTATCAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13616
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090043 Nonsense 233 534 6 8
Genomic Location:
Chromosome 22 (position 25102984)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTTCCCTGCAGATAYACCTCCGTTTYCTTGAGTACCAGATGGAGCACT[C/A]GAACGAGTGCAAGAAGAACTTTGTGGCCGTGTATGAYGGCAGCAGCGCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link