LOC556331

Ensembl ID:
ENSDARG00000062343
Human Orthologue:
NETO2
Human Description:
neuropilin (NRP) and tolloid (TLL)-like 2 [Source:HGNC Symbol;Acc:14644]
Mouse Orthologue:
Neto2
Mouse Description:
neuropilin (NRP) and tolloid (TLL)-like 2 Gene [Source:MGI Symbol;Acc:MGI:1921763]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14767 Nonsense Available for shipment Available now
sa13616 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14767
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090043 Nonsense 62 534 2 8
Genomic Location:
Chromosome 22 (position 25096047)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCCARTGGACCCGAAATATCAATGGAGGGCTWTTCACATCTCCGAACTA[T/A]CCAAACTCATATCCACCCAAYAAGGAGTGTGTGWACATCCTAGAAGGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13616
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090043 Nonsense 233 534 6 8
Genomic Location:
Chromosome 22 (position 25102984)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTTCCCTGCAGATAYACCTCCGTTTYCTTGAGTACCAGATGGAGCACT[C/A]GAACGAGTGCAAGAAGAACTTTGTGGCCGTGTATGAYGGCAGCAGCGCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fldcvwzo