si:ch211-233a24.2

Ensembl ID:
ENSDARG00000062330
ZFIN ID:
ZDB-GENE-090313-98
Description:
fragile site-associated protein [Source:RefSeq peptide;Acc:NP_001139056]
Human Orthologue:
KIAA1109
Human Description:
KIAA1109 [Source:HGNC Symbol;Acc:26953]
Mouse Orthologue:
4932438A13Rik
Mouse Description:
RIKEN cDNA 4932438A13 gene Gene [Source:MGI Symbol;Acc:MGI:2444631]

Alleles

There are 15 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42156 Nonsense Mutation detected in F1 DNA During 2017
sa15043 Essential Splice Site Available for shipment Available now
sa9351 Nonsense Mutation detected in F1 DNA During 2017
sa13514 Essential Splice Site Available for shipment Available now
sa42157 Nonsense Mutation detected in F1 DNA During 2017
sa35438 Nonsense Mutation detected in F1 DNA During 2017
sa2675 Nonsense F2 line generated During 2017
sa35439 Nonsense Mutation detected in F1 DNA During 2017
sa17693 Nonsense Available for shipment Available now
sa13875 Essential Splice Site Available for shipment Available now
sa2712 Nonsense F2 line generated During 2017
sa35440 Essential Splice Site Mutation detected in F1 DNA During 2017
sa24928 Nonsense Mutation detected in F1 DNA During 2017
sa35441 Nonsense Mutation detected in F1 DNA During 2017
sa13491 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42156
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090000 Nonsense 107 4871 4 83
ENSDART00000134725 Nonsense 107 4922 4 84

The following transcripts of ENSDARG00000062330 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 12673667)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 12672035
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATTTGTCATTTTCAGAATTCAGGATGGGTTACTCATATTTCGTTGGTG[G/A]AAGATGTACAACCCAAAGCAGAAGCAACATGGTCAGTGCAAAAACAGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15043
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090000 Essential Splice Site 454 4871 13 83
ENSDART00000134725 Essential Splice Site 454 4922 13 84

The following transcripts of ENSDARG00000062330 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 12700640)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 12699008
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATCAAASCGTTCTGCATAATAACAGCTGTTGTATGTTTACTTTTTTCCA[G/A]TTTCATGTGATAGCCAGTTATCCTCGCGTGTGGAACATGCCTCAGTCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9351
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090000 Nonsense 872 4871 21 83
ENSDART00000134725 Nonsense 872 4922 21 84

The following transcripts of ENSDARG00000062330 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 12716801)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 12715169
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCTCCGATWGAWGCYGTGTTGCGTGACGGGCAWCTGAGCCTCTCGGGTT[T/A]GCAGATGAGAGCTCATGCCATGTTCTCGGCGGAGGGTTTGCCGGCGGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13514
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090000 Essential Splice Site 1171 4871 25 83
ENSDART00000134725 Essential Splice Site 1171 4922 25 84

The following transcripts of ENSDARG00000062330 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 12730262)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 12728630
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATCCCGGAGAATGGATCGTCACCAAGGAAACTCCTAAAATCCCAGATG[G/A]TATGTTTGCTTTTAATGGACTAAATCATGATGCCTATTGCTTRTTGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42157
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090000 Nonsense 1178 4871 26 83
ENSDART00000134725 Nonsense 1182 4922 26 84

The following transcripts of ENSDARG00000062330 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 12730360)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 12728728
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCATTGTAGTAACTGATAGTTATATATGCAGCTAAAGGGATTGCTGTG[C/T]GAAGAGACACGTGTTCTCCTGCACCAGTGGTGGACTTGGAGAGACGTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35438
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090000 Nonsense 1254 4871 27 83
ENSDART00000134725 Nonsense 1258 4922 27 84

The following transcripts of ENSDARG00000062330 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 12735084)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 12733452
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGATTAATGAATGTAACAACCGATTGTCCTATCCCTGAAGGCCCACCAT[T/A]GCGCTCTCCTCTCCGCTCTCCATTAAAGCGCCAGTCCTCTGTCCAATCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2675
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090000 Nonsense 1380 4871 27 83
ENSDART00000134725 Nonsense 1384 4922 27 84

The following transcripts of ENSDARG00000062330 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 12735461)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 12733829
KASP Assay ID:
554-2464.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGGTCCTGGGACATATCCAGGGAGAAAGCGCAGACGGAGACAGCAGGGT[C/T]AGCCTCACACTGAACAMAGCCGCACCTCTATATACCACAGTGTTGAAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35439
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090000 Nonsense 3174 4871 54 83
ENSDART00000134725 Nonsense 3195 4922 55 84

The following transcripts of ENSDARG00000062330 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 12786535)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 12784903
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCGGGGTCAGATTTCCACCAGGTGGCCTATTTCCGGACTCGGATTGGTT[T/A]GCGCAATGCTCTGCAGGAGGAAATCAGTGGCAGCTCTGACAAAGAGGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17693
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090000 Nonsense 3227 4871 55 83
ENSDART00000134725 Nonsense 3248 4922 56 84

The following transcripts of ENSDARG00000062330 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 12787256)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 12785624
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTGCTCTTCTGGCWGAACTATAAGGCTGCTTATGATAACTGGAAGGAA[C/T]AACGCTTGGCTCTCAACTCCGACATTCATATGGCCACCAAAGARGTTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13875
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090000 Essential Splice Site 4289 4871 74 83
ENSDART00000134725 Essential Splice Site 4340 4922 75 84

The following transcripts of ENSDARG00000062330 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 12832029)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 12830397
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACAGCTTAATGTSCAGATGAACATGAGCAACGTCATGGGCAATAATAC[G/A]TATGASCGAGCGAGCAGCTAATATGCTTTGATACCTGCAWCTGGTTAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2712
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090000 Nonsense 4318 4871 75 83
ENSDART00000134725 Nonsense 4369 4922 76 84

The following transcripts of ENSDARG00000062330 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 12832212)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 12830580
KASP Assay ID:
554-3335.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCAGTGGGCAGCAACAGAGACCGTGAGATCAGCATGTCTATTGGAYTG[G/T]GACGCTCCAAACTGGACTCCAAAGGAGGAGTGGTGGGTGGAAACATTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35440
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090000 Essential Splice Site 4477 4871 77 83
ENSDART00000134725 Essential Splice Site 4528 4922 78 84

The following transcripts of ENSDARG00000062330 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 12836944)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 12835312
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTCCCAAAACACCAGTCATCAACACAGACAAGGCATCTGCTGAACTCT[G/T]TAAGTGCACTTATGACCAAAGTCCAGTTTTGTGTATAGGGTCTTGTTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24928
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090000 Nonsense 4556 4871 78 83
ENSDART00000134725 Nonsense 4607 4922 79 84

The following transcripts of ENSDARG00000062330 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 12839994)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 12838362
KASP Assay ID:
554-7847.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGTGTTGTTCCATCTGGAAGAGCCCAACATCGCCTTCTGGACTGAAGCA[C/T]AGAAGATCTGGGAGGATGGTACAGATGCAGTGCTGCTGTTTTATCATTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35441
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090000 Nonsense 4559 4871 78 83
ENSDART00000134725 Nonsense 4610 4922 79 84

The following transcripts of ENSDARG00000062330 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 12840005)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 12838373
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCTGGAAGAGCCCAACATCGCCTTCTGGACTGAAGCACAGAAGATCTG[G/A]GAGGATGGTACAGATGCAGTGCTGCTGTTTTATCATTCCCTTGAAATAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13491
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090000 Nonsense 4762 4871 82 83
ENSDART00000134725 Nonsense 4813 4922 83 84

The following transcripts of ENSDARG00000062330 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 12849590)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 12847958
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATGTTTGCATCTCGGCCTGGCCAGAAGAGCCCAACAAYGCAGCAGGAT[G/T]AGCCATCATCTGACAAGAAGGAGGAGAGAGAGAAAGAAGAAGGAGTGAAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Celiac disease: A genome-wide association study for celiac disease identifies risk variants in the region harboring IL2 and IL21. (View Study)
  • Celiac disease: Newly identified genetic risk variants for celiac disease related to the immune response. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link