si:ch211-247j24.2

Ensembl ID:
ENSDARG00000062328
ZFIN ID:
ZDB-GENE-091118-124
Human Orthologue:
RASGRP2
Human Description:
RAS guanyl releasing protein 2 (calcium and DAG-regulated) [Source:HGNC Symbol;Acc:9879]
Mouse Orthologue:
Rasgrp2
Mouse Description:
RAS, guanyl releasing protein 2 Gene [Source:MGI Symbol;Acc:MGI:1333849]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3110 Essential Splice Site F2 line generated During 2017

Mutation Details

Allele Name:
sa3110
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089980 Essential Splice Site 509 593 12 15
ENSDART00000132844 Essential Splice Site 481 547 11 13
Genomic Location (Zv9):
Chromosome 21 (position 27814033)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 28382944
KASP Assay ID:
554-2501.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAGACGAGCAGCATCAAGCCTTCATTTTGTCGCCACTGCTCTCGCTTG[G/A]TAAGTACACGTTTTATTTGTGGCTCAAACTCTTTATCTTCATCTCCAACG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Urate levels: Genome-wide association study for serum urate concentrations and gout among African Americans identifies genomic risk loci and a novel URAT1 loss-of-function allele. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link