shank2

Ensembl ID:
ENSDARG00000062325
ZFIN ID:
ZDB-GENE-061207-58
Description:
hypothetical protein LOC567595 [Source:RefSeq peptide;Acc:NP_001121819]
Human Orthologue:
SHANK2
Human Description:
SH3 and multiple ankyrin repeat domains 2 [Source:HGNC Symbol;Acc:14295]
Mouse Orthologue:
Shank2
Mouse Description:
SH3/ankyrin domain gene 2 Gene [Source:MGI Symbol;Acc:MGI:2671987]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14519 Nonsense Available for shipment Available now
sa38026 Nonsense Available for shipment Available now
sa38027 Essential Splice Site Mutation detected in F1 DNA During 2017
sa44255 Essential Splice Site, Missense Mutation detected in F1 DNA During 2017
sa31108 Essential Splice Site, Missense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa14519
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089981 Nonsense 194 1710 6 30
ENSDART00000145387 Nonsense 227 1800 5 21
Genomic Location (Zv9):
Chromosome 25 (position 14447017)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 14089940
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGGGKCTCATTTGGACTTTCGCTCCCGGGATGGCATGACTGCCCTGCAC[A/T]AAGCAGCCAGAGCCAAAAACCAGATCGCTCTCAAGGTAATAAATAACCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38026
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089981 Nonsense 566 1710 18 30
ENSDART00000145387 Nonsense 603 1800 13 21
Genomic Location (Zv9):
Chromosome 25 (position 14557375)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 14200298
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTCTTCACAGATGCCAGAGCGGACCGTTCAGAGAGAAGGAAGCTCTTT[C/T]GACACTACACTGTGGGATCTTATGACAGTTTTGATGCATCAAGGTACGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38027
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089981 Essential Splice Site 773 1710 25 30
ENSDART00000145387 Essential Splice Site 800 1800 18 21
Genomic Location (Zv9):
Chromosome 25 (position 14621416)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 14264339
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGCCACGTCCAACTAGCAAATGTTTTCCTGTCAGCCCTGAAATGAATG[T/G]AAGCGTGCCTTGTGTAATATCCCCTAGAGCTTCGGTCTCCTGTGATTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44255
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089981 Essential Splice Site 1260 1710 28 30
ENSDART00000145387 Missense 1324 1800 20 21
ENSDART00000089981 Essential Splice Site 1260 1710 28 30
ENSDART00000145387 Missense 1324 1800 20 21
ENSDART00000089981 Essential Splice Site 1260 1710 28 30
ENSDART00000145387 Missense 1324 1800 20 21
Genomic Location (Zv9):
Chromosome 25 (position 14623589)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 14266512
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGAAAGGGACGAGGGAGTGAGTCCCGACAACACCCCTGGGGAGCTTCGCG[A/T]CCCCAACCAGCCAGCTCCCACCAACCCCCCAGCCCCCAAGGCGCTATCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31108
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089981 Essential Splice Site 1260 1710 28 30
ENSDART00000145387 Missense 1324 1800 20 21
ENSDART00000089981 Essential Splice Site 1260 1710 28 30
ENSDART00000145387 Missense 1324 1800 20 21
ENSDART00000089981 Essential Splice Site 1260 1710 28 30
ENSDART00000145387 Missense 1324 1800 20 21
Genomic Location (Zv9):
Chromosome 25 (position 14623589)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 14266512
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGAAAGGGACGAGGGAGTGAGTCCCGACAACACCCCTGGGGAGCTTCGCG[A/T]CCCCAACCAGCCAGCTCCCACCAACCCCCCAGCCCCCAAGGCGCTATCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link