LOC559461

Ensembl ID:
ENSDARG00000062310
Human Orthologue:
WDR26
Human Description:
WD repeat domain 26 [Source:HGNC Symbol;Acc:21208]
Mouse Orthologue:
Wdr26
Mouse Description:
WD repeat domain 26 Gene [Source:MGI Symbol;Acc:MGI:1923825]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16691 Essential Splice Site Available for shipment Available now
sa36015 Nonsense Available for shipment Available now
sa13403 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16691
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089944 Essential Splice Site 395 586 10 15
Genomic Location (Zv9):
Chromosome 16 (position 3095938)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 2254835
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGCAAGCGTTTTGTTACCGGGGGTCAGAGAGGCCAGTTCTACMAGTGTG[T/C]AAGTGCCGTCGTTTTGTTACACCTGAGTGAATCTCATCAATCCGGGTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36015
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089944 Nonsense 412 586 11 15
Genomic Location (Zv9):
Chromosome 16 (position 3091298)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 2250195
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCTGGACGGGAACCTGCTAGACTCTTGGGAAGGCGTCCGTGTTCAGTG[T/A]CTGTGGTGTTTGGGTGACGGCAGGACAGTTCTGGCCTCAGACACACATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13403
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089944 Essential Splice Site 444 586 12 15
Genomic Location (Zv9):
Chromosome 16 (position 3091120)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 2250017
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGATATGYGCAGTTGTGTTAGTGTGTGTACAATGKTATTGTCTCTTACA[G/T]AGTTCAAGAGGACCATCCTAYAATGTCCTTCACMGTGTCAAAGAATGGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link