LOC559461

Ensembl ID:
ENSDARG00000062310
Human Orthologue:
WDR26
Human Description:
WD repeat domain 26 [Source:HGNC Symbol;Acc:21208]
Mouse Orthologue:
Wdr26
Mouse Description:
WD repeat domain 26 Gene [Source:MGI Symbol;Acc:MGI:1923825]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16691 Essential Splice Site Available for shipment Available now
sa13403 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16691
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089944 Essential Splice Site 395 586 10 15
Genomic Location:
Chromosome 16 (position 3095938)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGCAAGCGTTTTGTTACCGGGGGTCAGAGAGGCCAGTTCTACMAGTGTG[T/C]AAGTGCCGTCGTTTTGTTACACCTGAGTGAATCTCATCAATCCGGGTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13403
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089944 Essential Splice Site 444 586 12 15
Genomic Location:
Chromosome 16 (position 3091120)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGATATGYGCAGTTGTGTTAGTGTGTGTACAATGKTATTGTCTCTTACA[G/T]AGTTCAAGAGGACCATCCTAYAATGTCCTTCACMGTGTCAAAGAATGGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/a0jc7asf