si:ch211-239d6.1

Ensembl ID:
ENSDARG00000062305
ZFIN ID:
ZDB-GENE-060503-788
Description:
regulating synaptic membrane exocytosis protein 3 [Source:RefSeq peptide;Acc:NP_001093479]
Human Orthologue:
RIMS3
Human Description:
regulating synaptic membrane exocytosis 3 [Source:HGNC Symbol;Acc:21292]
Mouse Orthologue:
Rims3
Mouse Description:
regulating synaptic membrane exocytosis 3 Gene [Source:MGI Symbol;Acc:MGI:2443331]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36843 Nonsense Available for shipment Available now
sa36842 Nonsense Mutation detected in F1 DNA During 2017
sa1224 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36843
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104027 Nonsense 209 319 5 6
ENSDART00000139766 Nonsense 92 202 3 4
Genomic Location (Zv9):
Chromosome 19 (position 25652271)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 25582383
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTATACACTGGATGTTTTCTTCTCTGTCAGCAACATATATAAAGGTTTA[T/A]GTCCTGGAGAACGGGATGTGTCTTGCTAAGAAGAAAACCAAAGTGGTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36842
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104027 Nonsense 244 319 5 6
ENSDART00000139766 Nonsense 127 202 3 4
Genomic Location (Zv9):
Chromosome 19 (position 25652168)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 25582280
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACCCTGGATCCAACCTTCCAGCAGTCCCTGATGTTTGATGAGAGCCCG[C/T]AGGGGAAAGTGCTACAGGTATCACAAATTATATAAAGCACTCTGAGATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1224
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104027 Nonsense 256 319 6 6
ENSDART00000139766 Nonsense 139 202 4 4
Genomic Location (Zv9):
Chromosome 19 (position 25649397)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 25579509
KASP Assay ID:
554-1133.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAATGATCTTTCATGTATAACTTTCCCAGGTGATCGTGTGGGGTGAYTA[C/A]GGCCGCATGGACAGCAAGTGTTTCATGGGAATGGCTCAGATCCTCCTGGA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link