pdpk1a

Ensembl ID:
ENSDARG00000062304
ZFIN ID:
ZDB-GENE-061013-109
Description:
3-phosphoinositide-dependent protein kinase 1 [Source:RefSeq peptide;Acc:NP_001070812]
Human Orthologues:
AC141586.1, PDPK1
Human Descriptions:
3-phosphoinositide dependent protein kinase-1 [Source:HGNC Symbol;Acc:8816]
Putative 3-phosphoinositide-dependent protein kinase 2 [Source:UniProtKB/Swiss-Prot;Acc:Q6A1A2]
Mouse Orthologue:
Pdpk1
Mouse Description:
3-phosphoinositide dependent protein kinase 1 Gene [Source:MGI Symbol;Acc:MGI:1338068]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5221 Essential Splice Site F2 line generated During 2017
sa20114 Essential Splice Site Available for shipment Available now
sa38407 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa5221
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102245 Essential Splice Site 90 536 1 13
Genomic Location (Zv9):
Chromosome 3 (position 45336265)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 47345818
KASP Assay ID:
554-3499.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAGGACTTCAGCTTTGGCAAAATTTTAGGAGAGGGCTCCTTTTCAACG[G/A]TGGGTGATTTTGCTGTTTTCAATAGCCCAGGTAGCAGATATTATGAAAYA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20114
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102245 Essential Splice Site 312 536 8 13
Genomic Location (Zv9):
Chromosome 3 (position 45329942)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 47339495
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTGAGAAGTTCTTCCCAAAAGCTAAAGATCTGGTCCAGCGTCTGTTGG[T/C]AATCATGTTTGTTTTCATGATACATGCTTTCGGTTTGTTTTGCATGGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38407
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102245 Essential Splice Site 456 536 12 13
Genomic Location (Zv9):
Chromosome 3 (position 45326438)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 47335991
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTGACTGCAGTTGGTAATAACAGCTTTTTTCTTGTTTGTTGTTGTCAC[A/T]GGGGCTGTTTGCTCGACGCCGTCAGCTTTTACTAACTGAAGGACCGCATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link