si:ch211-191j22.6

Ensembl ID:
ENSDARG00000062293
ZFIN ID:
ZDB-GENE-091118-40
Human Orthologue:
QPCTL
Human Description:
glutaminyl-peptide cyclotransferase-like [Source:HGNC Symbol;Acc:25952]
Mouse Orthologue:
Qpctl
Mouse Description:
glutaminyl-peptide cyclotransferase-like Gene [Source:MGI Symbol;Acc:MGI:1914619]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32342 Nonsense Available for shipment Available now
sa43628 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa32342
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089898 Nonsense 112 391 2 7
Genomic Location (Zv9):
Chromosome 21 (position 20155948)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 21291437
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGGTATTTCCAGCTGCGACCCATTCTCATTCAGCGACAGCCTGGAAGT[C/T]GAGGAAGTCGAGCTGTTCGTAAAGTAAGACATGTCTGATTTACTATCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43628
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089898 Nonsense 264 391 4 7
Genomic Location (Zv9):
Chromosome 21 (position 20159121)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 21294610
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCATCTCGCAGAATACATGTCCAGCATTCCTCATCCACCGGGATCTGAA[C/T]AAACCACACTTCTCAATGCCGTGGTAAGATGACATGAATGTGTATGTGCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Body mass index: Association analyses of 249,796 individuals reveal 18 new loci associated with body mass index. (View Study)
  • Body mass index: Meta-analysis identifies common variants associated with body mass index in east Asians. (View Study)
  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link