LOC566761

Ensembl ID:
ENSDARG00000062289
Human Orthologue:
EDARADD
Human Description:
EDAR-associated death domain [Source:HGNC Symbol;Acc:14341]
Mouse Orthologue:
Edaradd
Mouse Description:
EDAR (ectodysplasin-A receptor)-associated death domain Gene [Source:MGI Symbol;Acc:MGI:1931001]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2944 Essential Splice Site Mutation detected in F1 DNA During 2014
sa23062 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa2944
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089916 Essential Splice Site 94 219 5 6
Genomic Location:
Chromosome 17 (position 22369275)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGGAAAATGACGATAGTGAATGTATTACATCAGCGTCTGTTTCATCAG[G/A]TATGTGTCACTGGTTGAAAAACTACCATTACTACACTGTATACATAACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23062
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089916 Nonsense 214 219 6 6
Genomic Location:
Chromosome 17 (position 22371224)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGACGTGCTGCGGTTGCTCCAGCGCTGGATGGAGAACGACTGGCCATCA[C/T]GATGGCAGAAGGCCCATTAGCTGCCACTTGACTAAAACTGGACCTCAATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/v6h9vw6d