HACE1

Ensembl ID:
ENSDARG00000062280
Description:
HECT domain and ankyrin repeat containing, E3 ubiquitin protein ligase 1 [Source:HGNC Symbol;Acc:210
Human Orthologue:
HACE1
Human Description:
HECT domain and ankyrin repeat containing, E3 ubiquitin protein ligase 1 [Source:HGNC Symbol;Acc:210
Mouse Orthologue:
Hace1
Mouse Description:
HECT domain and ankyrin repeat containing, E3 ubiquitin protein ligase 1 Gene [Source:MGI Symbol;Acc

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22738 Essential Splice Site Mutation detected in F1 DNA During 2014
sa13490 Nonsense Available for shipment Available now
sa16955 Nonsense Available for shipment Available now
sa4633 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22738
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089855 Essential Splice Site 276 908 9 25
Genomic Location:
Chromosome 16 (position 3683759)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGACGCTGATACAGATGACCCAGAATGATGACATTAAAGAGAACATG[G/A]TACACCTCTTTCATCACCTCTGACGTTCTTGATCATTTTGAAGTCCTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13490
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089855 Nonsense 527 908 15 25
Genomic Location:
Chromosome 16 (position 3694912)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCTTCTCTTCTYCTTCTTAGCCGTTTAAAGACCGGTGCGAGTGGTTTTA[T/G]GAACATCTTCTTGCTGGACAGCCAGACTCCGATATGGTGCATCGRCCGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16955
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089855 Nonsense 563 908 16 25
Genomic Location:
Chromosome 16 (position 3697507)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGCTGTGTGCTATCATCTCGTTTCAGACTCGTTATTCAGAAGCAGCTGY[G/T]AAGTCGTGTCCAAGTCCTCCAATGAGAAACTCAAACAAGGCATCGCCGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4633
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089855 Essential Splice Site 667 908 18 25
Genomic Location:
Chromosome 16 (position 3703053)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCTGGTGAACATCTACTTCACACGCTCCTTTTACAAGCATATTCTGGG[T/C]AACACATTCCACTCACATCGTGTTTRCTATCATACTGTCACAGTACTAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/dngsu3vm