si:dkey-202e17.1

Ensembl ID:
ENSDARG00000062278
ZFIN ID:
ZDB-GENE-060503-810
Description:
hypothetical protein LOC555344 [Source:RefSeq peptide;Acc:NP_001121803]
Human Orthologue:
C1GALT1
Human Description:
core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase, 1 [Source:HGNC Sym
Mouse Orthologue:
C1galt1
Mouse Description:
core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase, 1 Gene [Source:MGI

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39247 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39247
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089882 Nonsense 124 316 2 3
ENSDART00000133150 Nonsense 55 247 2 3
Genomic Location (Zv9):
Chromosome 19 (position 26004813)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 25934925
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGGGCTCAATGTGTCAGAAGGACGCAATCAACTCTACTGGAAGACCATA[C/T]GAGCCTTCCAGTACATTCACAAGCACCATTTGGATGATGCTGATTGGTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Normalized brain volume: Genome-wide association analysis of susceptibility and clinical phenotype in multiple sclerosis. (View Study)
  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link