LOC559392

Ensembl ID:
ENSDARG00000062277
Human Orthologue:
PPP2R2C
Human Description:
protein phosphatase 2, regulatory subunit B, gamma [Source:HGNC Symbol;Acc:9306]
Mouse Orthologue:
Ppp2r2c
Mouse Description:
protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), gamma isoform Gene [Source:MGI Sy

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15786 Nonsense Available for shipment Available now
sa6341 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa15786
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089867 Nonsense 55 447 3 9
Genomic Location:
Chromosome 14 (position 22213764)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTAATGACTGTCATTTTTACCCYGTTACCTYTCTCTTTYAGGGCGAGTA[T/A]AATGTGTATAGTACATTTCAGAGTCATGAGCCTGAATTCGATTACCTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6341
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089867 Nonsense 440 447 9 9
Genomic Location:
Chromosome 14 (position 22206671)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTACATTTTTCAAGACAGACYGACRCCCAACGGACATCATAATACGCCC[G/T]AAATACAAAGTGCACCTCCCAAATGACGATCCTTCTGTAAAAGTTACAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ujmytdpe