si:ch211-12e1.4

Ensembl ID:
ENSDARG00000062272
ZFIN ID:
ZDB-GENE-070912-46
Description:
AFG3-like protein 2 [Source:RefSeq peptide;Acc:NP_001104667]
Human Orthologue:
AFG3L2
Human Description:
AFG3 ATPase family gene 3-like 2 (S. cerevisiae) [Source:HGNC Symbol;Acc:315]
Mouse Orthologue:
Afg3l2
Mouse Description:
AFG3(ATPase family gene 3)-like 2 (yeast) Gene [Source:MGI Symbol;Acc:MGI:1916847]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19731 Nonsense Available for shipment Available now
sa6834 Nonsense Mutation detected in F1 DNA During 2017
sa14600 Nonsense Available for shipment Available now
sa1333 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19731
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089834 Nonsense 50 800 2 17
Genomic Location (Zv9):
Chromosome 2 (position 21251759)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 21797174
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTGTTGGACAAATTGTCCTAGACAGAAGATCCTTGCTCTCTCAGGTCT[T/A]GGGCACTTATAGAAGATTAAGCTCCAAACCTCCTAAAGGTGTGAAAGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6834
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089834 Nonsense 469 800 11 17
Genomic Location (Zv9):
Chromosome 2 (position 21258489)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 21803904
KASP Assay ID:
554-5234.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTCTAGATCCAGCTCTAATGAGGCCTGGACGCTTYGATAGACAGATATA[T/A]ATCGGTAMGGAGTTTGTCRCTTTTTATTTTAAAGAAGTAGATTTCATAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14600
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089834 Nonsense 608 800 15 17
Genomic Location (Zv9):
Chromosome 2 (position 21260393)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 21805808
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATCCCACGTGGAAAGGGTTTAGGCTACGCCCAGTATTTGCCCAAAGAG[C/T]AGTATCTGTACACCAAGGAGCAGCTGCTGGACAGGATGTGCATGACTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1333
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089834 Essential Splice Site 720 800 16 17
Genomic Location (Zv9):
Chromosome 2 (position 21263184)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 21808599
KASP Assay ID:
554-1247.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGAGCGAACGCAACAACTGCTCTCTGACAAGAAGCCTGAGGTGGAGAAG[G/A]TACAGCAAACTTTTGCCAGATTACATCAGAATGGCACATACACTCCAGTC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link