fan1

Ensembl ID:
ENSDARG00000062269
ZFIN ID:
ZDB-GENE-030131-6225
Description:
Fanconi-associated nuclease 1 [Source:UniProtKB/Swiss-Prot;Acc:Q1LWH4]
Human Orthologue:
FAN1
Human Description:
FANCD2/FANCI-associated nuclease 1 [Source:HGNC Symbol;Acc:29170]
Mouse Orthologue:
Fan1
Mouse Description:
FANCD2/FANCI-associated nuclease 1 Gene [Source:MGI Symbol;Acc:MGI:3045266]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11704 Nonsense Available for shipment Available now
sa23297 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11704
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089853 Nonsense 352 988 2 14
Genomic Location:
Chromosome 18 (position 21504887)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCAGCMCACCAGGYTGCCTTATTATCTGCGAAACTTTCGGACTGTCCTT[G/T]AGGCTGTGTTGGARAAYGAGGATGAKAGGAGGCTCTTCAATGAAGACGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23297
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089853 Nonsense 704 988 9 14
Genomic Location:
Chromosome 18 (position 21478516)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATCAAGGCCATCGGTGCTATCCGGGATGGACTGAATGACCCTCTGGCC[C/T]GAACAGGACATAAGTTGTCACTTTACCAGCGAGCTTCACGAATGAAGGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/x5q8cjar