jarid2b

Ensembl ID:
ENSDARG00000062268
ZFIN ID:
ZDB-GENE-060503-246
Description:
Protein Jumonji [Source:UniProtKB/Swiss-Prot;Acc:Q1LVC2]
Human Orthologue:
JARID2
Human Description:
jumonji, AT rich interactive domain 2 [Source:HGNC Symbol;Acc:6196]
Mouse Orthologue:
Jarid2
Mouse Description:
jumonji, AT rich interactive domain 2 Gene [Source:MGI Symbol;Acc:MGI:104813]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36845 Essential Splice Site Mutation detected in F1 DNA During 2016
sa10625 Essential Splice Site Available for shipment Available now
sa9905 Nonsense Available for shipment Available now
sa36846 Nonsense Mutation detected in F1 DNA During 2016
sa39248 Nonsense Mutation detected in F1 DNA During 2016
sa36847 Essential Splice Site Mutation detected in F1 DNA During 2016
sa3042 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa36845
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089836 Essential Splice Site 15 1303 1 18
ENSDART00000147627   None 1304 None 17
Genomic Location:
Chromosome 19 (position 26457172)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAATGAGCAAGGAAAGACCTAAGAGGAATATCATTCAGAAGAAATACG[T/G]AAGTGTTGATCTTTCGTATGCGGCTGATCTTAAGTTTGTTCGATGGTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10625
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089836 Essential Splice Site 100 1303 4 18
ENSDART00000147627 Essential Splice Site 85 1304 3 17
Genomic Location:
Chromosome 19 (position 26597050)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YAGAGGGCAAGTGTATTTAAAATCTATTGTTTNNTCTCTNTTTTTTTCTGTTC[A/T]GGCCCAGACTGCATGCACAGAGRARGTTTGCTCAGTCTCAACCCAACTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9905
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089836 Nonsense 531 1303 7 18
ENSDART00000147627 Nonsense 516 1304 6 17
Genomic Location:
Chromosome 19 (position 26623002)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCAGCTTCCCCGTCCATGCCCCAGAACCCTGCAATCCCTGAGCCAGCA[C/T]GACAGCGACCCAAACGTGCCTCTGCTGGCAAACTGATGTTCATCAGAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36846
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089836 Nonsense 688 1303 7 18
ENSDART00000147627 Nonsense 673 1304 6 17
Genomic Location:
Chromosome 19 (position 26623473)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGGGCCCAATGTTCAAAAACTTGCCTGCATTAAGAAGCACCTCAAATCT[C/T]AGGGCATCTCAATGGATCAGCCACCTGTTATAGGCAAGTCCTTTAAATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39248
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089836 Nonsense 701 1303 8 18
ENSDART00000147627 Nonsense 702 1304 7 17
Genomic Location:
Chromosome 19 (position 26624827)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCACAAGTTTAACAATCCCTTCTTCCATCTCACCCCTTCAGGTGGCTG[T/A]GAAGTAGATTTGGCTCGTTTTTCTGAGCTGGTCTGTGACTTGGGTGGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36847
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089836 Essential Splice Site 1204 1303 16 18
ENSDART00000147627 Essential Splice Site 1205 1304 15 17
Genomic Location:
Chromosome 19 (position 26634909)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCAGAGAGGCGCTGCCAAATGTGCCAGCACCTCTGCTACTTATCTATG[G/A]TGAGATTATATCAGGTTATATTATCCTGCATTGCATACAAGGGTATTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3042
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089836 Nonsense 1242 1303 18 18
ENSDART00000147627 Nonsense 1243 1304 17 17
Genomic Location:
Chromosome 19 (position 26642008)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCAAAARTTTTAAACGTTTCTTCCCCATCTCTGTATGTCCCTGCAGGAA[C/T]AGATCAACAGTTTGGTGAATCAGGTGTGTGGTAAAGCRCTGGTGAGAAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Lymphoma: Susceptibility loci associated with specific and shared subtypes of lymphoid malignancies. (View Study)
  • Normalized brain volume: Genome-wide association analysis of susceptibility and clinical phenotype in multiple sclerosis. (View Study)
  • Ovarian reserve: Genetic variants and environmental factors associated with hormonal markers of ovarian reserve in Caucasian and African American women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link