jarid2b

Ensembl ID:
ENSDARG00000062268
ZFIN ID:
ZDB-GENE-060503-246
Description:
Protein Jumonji [Source:UniProtKB/Swiss-Prot;Acc:Q1LVC2]
Human Orthologue:
JARID2
Human Description:
jumonji, AT rich interactive domain 2 [Source:HGNC Symbol;Acc:6196]
Mouse Orthologue:
Jarid2
Mouse Description:
jumonji, AT rich interactive domain 2 Gene [Source:MGI Symbol;Acc:MGI:104813]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10625 Essential Splice Site Available for shipment Available now
sa9905 Nonsense Available for shipment Available now
sa3042 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa10625
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089836 Essential Splice Site 100 1303 4 18
ENSDART00000147627 Essential Splice Site 85 1304 3 17
Genomic Location:
Chromosome 19 (position 26597050)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YAGAGGGCAAGTGTATTTAAAATCTATTGTTTNNTCTCTNTTTTTTTCTGTTC[A/T]GGCCCAGACTGCATGCACAGAGRARGTTTGCTCAGTCTCAACCCAACTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9905
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089836 Nonsense 531 1303 7 18
ENSDART00000147627 Nonsense 516 1304 6 17
Genomic Location:
Chromosome 19 (position 26623002)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCAGCTTCCCCGTCCATGCCCCAGAACCCTGCAATCCCTGAGCCAGCA[C/T]GACAGCGACCCAAACGTGCCTCTGCTGGCAAACTGATGTTCATCAGAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3042
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089836 Nonsense 1242 1303 18 18
ENSDART00000147627 Nonsense 1243 1304 17 17
Genomic Location:
Chromosome 19 (position 26642008)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCAAAARTTTTAAACGTTTCTTCCCCATCTCTGTATGTCCCTGCAGGAA[C/T]AGATCAACAGTTTGGTGAATCAGGTGTGTGGTAAAGCRCTGGTGAGAAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Lymphoma: Susceptibility loci associated with specific and shared subtypes of lymphoid malignancies. (View Study)
  • Normalized brain volume: Genome-wide association analysis of susceptibility and clinical phenotype in multiple sclerosis. (View Study)
  • Ovarian reserve: Genetic variants and environmental factors associated with hormonal markers of ovarian reserve in Caucasian and African American women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rj3xh9j4