im:7163548

Ensembl ID:
ENSDARG00000062267
ZFIN ID:
ZDB-GENE-060810-184
Human Orthologues:
KDM3A, KDM3B
Human Descriptions:
lysine (K)-specific demethylase 3A [Source:HGNC Symbol;Acc:20815]
lysine (K)-specific demethylase 3B [Source:HGNC Symbol;Acc:1337]
Mouse Orthologues:
Kdm3a, Kdm3b
Mouse Descriptions:
KDM3B lysine (K)-specific demethylase 3B Gene [Source:MGI Symbol;Acc:MGI:1923356]
lysine (K)-specific demethylase 3A Gene [Source:MGI Symbol;Acc:MGI:98847]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10590 Nonsense Available for shipment Available now
sa15916 Essential Splice Site Available for shipment Available now
sa35680 Essential Splice Site Mutation detected in F1 DNA During 2016
sa35679 Nonsense Available for shipment Available now
sa42386 Essential Splice Site Mutation detected in F1 DNA During 2016
sa8914 Essential Splice Site Mutation detected in F1 DNA During 2016
sa22464 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10590
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089845 Nonsense 461 1776 9 26
Genomic Location (Zv9):
Chromosome 14 (position 22656985)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 21358473
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTTCAGACCCCTAAAGCCCCTGTTCTAGCTCCTGCTGGATTTGGTAAA[C/T]AGTCCAGTGGAGGGGTGTTTGGGAATGTCTCAACACAGACTAATGGATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15916
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089845 Essential Splice Site 929 1776 10 26
Genomic Location (Zv9):
Chromosome 14 (position 22653936)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 21355424
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGATGATGAYGACCCAAATGTAGYCTGTCGATTCTTTCACTTTCGCAG[G/A]TGAATATGATTCTGGTATATTTAGCTTTACTTATATCTGAACTGTGATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35680
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089845 Essential Splice Site 1001 1776 11 26
Genomic Location (Zv9):
Chromosome 14 (position 22653642)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 21355130
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATTGGTCATGTCAGAGAAAGAAGCCATGATGATGGTAGAACCACATCG[T/C]AAGTAACAATTTTAACAGTTATTTAAAATTCATTTAAGGCTCATTTATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35679
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089845 Nonsense 1241 1776 15 26
Genomic Location (Zv9):
Chromosome 14 (position 22647162)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 21348650
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAGCAAGAGCAGTTCTTCAGCACTTCACTGGCTGGCAGATCTGGCCACA[C/T]AAAAGGAGCCCAAAGGTGAGACTCGAATATAGAGCACTTTACAGTGAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42386
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089845 Essential Splice Site 1421 1776 18 26
Genomic Location (Zv9):
Chromosome 14 (position 22641586)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 21343074
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCAGTTGCGTTCTGCTAATGCTAATGAAGTGTTTTTCCTCTTTTTTTA[G/A]CCTGTGCTGGTCTCAGGCATACACAGGAAGCTGAAGGAACACTTATGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8914
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089845 Essential Splice Site 1592 1776 21 26
Genomic Location (Zv9):
Chromosome 14 (position 22638163)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 21339651
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTATGGTGTATGTGGGCATCCCAGAAGGAGAGAATGACCAAGAAAGTGG[T/G]AAATATRAGTCARTTTTATTTTTGAAAGCAGCATCATTTAGAATATTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22464
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089845 Nonsense 1667 1776 24 26
Genomic Location (Zv9):
Chromosome 14 (position 22631408)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 21332896
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGGTCAAGAGAACCCACCAGACCATGATCCTATCCATGACCAGAGCTG[G/A]TACCTGGACCAGACGTTGCGTCGCAGGCTGTATGAGGAGTATGGAGTCCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link