edc4

Ensembl ID:
ENSDARG00000062266
ZFIN ID:
ZDB-GENE-030131-5032
Description:
Enhancer of mRNA-decapping protein 4 [Source:UniProtKB/Swiss-Prot;Acc:Q1LUT1]
Human Orthologue:
EDC4
Human Description:
enhancer of mRNA decapping 4 [Source:HGNC Symbol;Acc:17157]
Mouse Orthologue:
Edc4
Mouse Description:
enhancer of mRNA decapping 4 Gene [Source:MGI Symbol;Acc:MGI:2446249]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23299 Nonsense Mutation detected in F1 DNA During 2014
sa23298 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23299
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089787 Nonsense 765 1384 18 29
ENSDART00000132381 Nonsense 750 1361 18 29
Genomic Location:
Chromosome 18 (position 21677946)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCCACCTGCTATCTCCAAGGGCCCGGAGCAGCGCTGAGCACAGTTTGT[T/A]GCCTCTTGAATTGGGTGCAGCGTCTGTGGATGGAGAGCAGAGACTCAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23298
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089787 Essential Splice Site 1040 1384 23 29
ENSDART00000132381 Essential Splice Site 1017 1361 23 29
Genomic Location:
Chromosome 18 (position 21668838)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGCTTGAGAAAGTTTTGCGTGAAGAAATGAAGAAAACCGTCCCGCAGAG[T/C]AAGTGCTGATGTGATGAACTTTTTTAAGAGCTCAACTTAGCTTTTTTTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Coronary heart disease: Genome-wide association study of coronary heart disease and its risk factors in 8,090 African Americans: the NHLBI CARe Project. (View Study)
  • Metabolic syndrome: Genome-wide screen for metabolic syndrome susceptibility Loci reveals strong lipid gene contribution but no evidence for common genetic basis for clustering of metabolic syndrome traits. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/dlh85urn