ptpn21

Ensembl ID:
ENSDARG00000062248
ZFIN ID:
ZDB-GENE-080102-4
Description:
Protein-tyrosine phosphatase D1 [Source:UniProtKB/TrEMBL;Acc:C7U116]
Human Orthologue:
PTPN21
Human Description:
protein tyrosine phosphatase, non-receptor type 21 [Source:HGNC Symbol;Acc:9651]
Mouse Orthologue:
Ptpn21
Mouse Description:
protein tyrosine phosphatase, non-receptor type 21 Gene [Source:MGI Symbol;Acc:MGI:1344406]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22978 Nonsense Available for shipment Available now
sa15217 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22978
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097705 Nonsense 47 244 2 5
ENSDART00000135374 Nonsense 576 837 5 9
Genomic Location (Zv9):
Chromosome 17 (position 2400937)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 2446582
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTTCACGGAGTACGAGCAGGTGCCCAAGAAACGACCCAACAGTGAGTA[C/A]AGCATCGCTCAGATGCCCGAGAACAACGACAGAAACCGCTTTCAGGACGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15217
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097705 Nonsense 122 244 3 5
ENSDART00000135374 Nonsense 651 837 6 9
Genomic Location (Zv9):
Chromosome 17 (position 2397435)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 2443080
KASP Assay ID:
2261-0491.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGGTCCGCTTTCCAGCACCTGTCAGGATTTCTGGCAGATGGTTTGGGAA[C/T]AAGGAGTSWCCATCATCGCAATGGTTAMAGCAGAGGAGGTGAAGTAGAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link