FAT3 (2 of 4)

Ensembl ID:
ENSDARG00000062246
Description:
FAT tumor suppressor homolog 3 (Drosophila) [Source:HGNC Symbol;Acc:23112]
Human Orthologue:
FAT3
Human Description:
FAT tumor suppressor homolog 3 (Drosophila) [Source:HGNC Symbol;Acc:23112]
Mouse Orthologue:
Fat3
Mouse Description:
FAT tumor suppressor homolog 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2444314]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15618 Nonsense Available for shipment Available now
sa12567 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15618
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089789 Nonsense 163 268 3 4
Genomic Location:
Chromosome 10 (position 25787909)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTCCAAGATGAAAATGACAACACTCCWGAATTCAAAGAGTCTATTTAT[C/T]GAATCAGCYTTCCAGAGCGGGATCGAAACAAACGCGGAGACCCAGTCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12567
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089789 Nonsense 163 268 3 4
Genomic Location:
Chromosome 10 (position 25787909)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTCCAAGATGAAAATGACAACACTCCWGAATTCAAAGAGTCTATTTAT[C/T]GAATCAGCYTTCCAGAGCGGGATCGAAACAAACGCGGAGACCCAGTCTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7y8n0985