crb1

Ensembl ID:
ENSDARG00000062245
ZFIN IDs:
ZDB-GENE-050208-382, ZDB-GENE-050208-543, ZDB-GENE-050208-543
Description:
crumbs homolog 1 [Source:RefSeq peptide;Acc:NP_001038408]
Human Orthologue:
CRB1
Human Description:
crumbs homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:2343]
Mouse Orthologue:
Crb1
Mouse Description:
crumbs homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2136343]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14330 Nonsense Available for shipment Available now
sa29788 Essential Splice Site Mutation detected in F1 DNA During 2016
sa1482 Nonsense Available for shipment Available now
sa12558 Nonsense Available for shipment Available now
sa159 Essential Splice Site Confirmed mutation in F2 line During 2016
sa24173 Nonsense Available for shipment Available now
sa24174 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14330
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089774 Nonsense 155 1428 2 13
ENSDART00000141006 Nonsense 155 1428 2 13
Genomic Location (Zv9):
Chromosome 22 (position 24368195)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23504549
KASP Assay ID:
2261-6861.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ARYCCAGGGTACGCATGCATCTGTCAGGAGGGTTACACTGGRAGATCTTG[C/A]GARAAAGAGGTGGACCACTGCTCTCCTAACCCCTGCMGAAACCGCGCCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29788
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089774 Essential Splice Site 340 1428 4 13
ENSDART00000141006 Essential Splice Site 340 1428 4 13
Genomic Location (Zv9):
Chromosome 22 (position 24375394)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23497350
KASP Assay ID:
2261-6862.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCCCTCTGTGAGAATCAACAGGAGAACTACACCTGCAACTGCTGGCCAG[G/T]TGACTCGCAGAATGACTTGTATATCAAGTTAAAGTATGATTTTGCATTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1482
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089774 Nonsense 355 1428 5 13
ENSDART00000141006 Nonsense 355 1428 5 13
Genomic Location (Zv9):
Chromosome 22 (position 24377070)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23495674
KASP Assay ID:
554-1407.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTTCCAGGGTTTGAAGGGCGTAACTGTGAGGTAGACGTCAGTGAATGT[G/T]AAAGCAATCCCTGTGTGAATGAAGGCATTTGCATGGAGCTTTCTTGGAAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa12558
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089774 Nonsense 509 1428 6 13
ENSDART00000141006 Nonsense 509 1428 6 13
Genomic Location (Zv9):
Chromosome 22 (position 24380974)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23491770
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACGCTCACTGTGTTCTCCTTTGAGACAAGCAGAGCATTCTTGCACCTG[C/T]AGACCCCRCTGCTGGGTGCAGAAACWTAYTTCAATATCACGCTAAGCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa159
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089774 Essential Splice Site 896 1428 7 13
ENSDART00000141006 Essential Splice Site 896 1428 7 13
Genomic Location (Zv9):
Chromosome 22 (position 24383929)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23488815
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCGCGTTGTGAAAGTTACTGCAGGCTGCACCAGTGATGACACTTGCTCA[G/C]TAAGTTACAATGAGAAGTCTCATGAGATTTCAACTGCAACTGTACAACGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24173
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089774 Nonsense 987 1428 9 13
ENSDART00000141006 Nonsense 987 1428 9 13
Genomic Location (Zv9):
Chromosome 22 (position 24386577)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23486167
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTGATATCCCGCCATCTGACCAGTATTGTCTTTAATATCCGTACACGT[A/T]AGCGCAATGCCATAGTGTTGCATGCAGAGAGTGGATCAGAGTTTGTAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24174
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089774 Nonsense 993 1428 9 13
ENSDART00000141006 Nonsense 993 1428 9 13
Genomic Location (Zv9):
Chromosome 22 (position 24386596)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23486148
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACCAGTATTGTCTTTAATATCCGTACACGTAAGCGCAATGCCATAGTGT[T/A]GCATGCAGAGAGTGGATCAGAGTTTGTAACTGTATCTCTTCAAGATGGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link