setd2

Ensembl ID:
ENSDARG00000062244
ZFIN ID:
ZDB-GENE-030131-2140
Description:
Huntingtin interacting protein B [Source:UniProtKB/TrEMBL;Acc:Q071D9]
Human Orthologue:
SETD2
Human Description:
SET domain containing 2 [Source:HGNC Symbol;Acc:18420]
Mouse Orthologue:
Setd2
Mouse Description:
SET domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1918177]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25011 Nonsense Mutation detected in F1 DNA During 2017
sa42691 Nonsense Mutation detected in F1 DNA During 2017
sa39086 Nonsense Mutation detected in F1 DNA During 2017
sa22792 Essential Splice Site Available for shipment Available now
sa9194 Essential Splice Site Mutation detected in F1 DNA During 2017
sa36079 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25011
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089776   None 508 None 7
ENSDART00000111446 Nonsense 968 2737 3 21
ENSDART00000131779   None 285 None 7
ENSDART00000137672 Nonsense 968 2737 4 22
Genomic Location (Zv9):
Chromosome 16 (position 18320188)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 16361425
KASP Assay ID:
554-7516.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGACAAGGCTGAACCCGCCCCTGCTTCCTCGTTGTTTTCTGGGAATCAG[C/T]AAACTGATACACATGAAAGCATTAATAAAGAATTTCCTTACGGATTTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42691
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089776   None 508 None 7
ENSDART00000111446 Nonsense 1264 2737 3 21
ENSDART00000131779 Nonsense 16 285 1 7
ENSDART00000137672 Nonsense 1264 2737 4 22
Genomic Location (Zv9):
Chromosome 16 (position 18321077)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 16362314
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGGCAGGCCTGAGTAAAAGGGAGTGTTTTGATGAGAGCTCAAGGCCTT[T/A]GAAAGATGCTAAGGAGTCTTTCCATCAAATTCAAGAGGTTCAGCGACCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39086
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089776   None 508 None 7
ENSDART00000111446 Nonsense 1342 2737 4 21
ENSDART00000131779 Nonsense 94 285 2 7
ENSDART00000137672 Nonsense 1342 2737 5 22
Genomic Location (Zv9):
Chromosome 16 (position 18322470)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 16363707
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGACATTAAGCGTATGCAGTGTGAGTGTGCTATCCTTTCAAAAGAAGAG[C/T]GAGCCCGAGGAATACTGGCATGTGGGGAAGATTGCCTGAATCGCTTGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22792
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089776   None 508 None 7
ENSDART00000111446 Essential Splice Site 1405 2737 5 21
ENSDART00000131779 Essential Splice Site 157 285 3 7
ENSDART00000137672 Essential Splice Site 1405 2737 6 22
Genomic Location (Zv9):
Chromosome 16 (position 18323478)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 16364715
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGACTGAGAGCAAAGGATGGGGTTTACGAGCAGCTAAAGACCTCCAGCC[G/A]TAAGTACCGTATGGTTCAACTAATAGTTTTTTTTGGGGTACATTTAAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9194
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089776   None 508 None 7
ENSDART00000111446 Essential Splice Site 1446 2737 6 21
ENSDART00000131779 Essential Splice Site 198 285 4 7
ENSDART00000137672 Essential Splice Site 1446 2737 7 22
Genomic Location (Zv9):
Chromosome 16 (position 18323706)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 16364943
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCGAAACAAGAACATTCACTATTATTTCATGGCTTTGAAAAATAATGAG[G/A]TAAGTCATCAGCGCACTAAAAYCTACAAATTAGAACWGTTGGTAATCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36079
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089776 Nonsense 363 508 4 7
ENSDART00000111446 Nonsense 2592 2737 18 21
ENSDART00000131779   None 285 None 7
ENSDART00000137672 Nonsense 2592 2737 19 22
Genomic Location (Zv9):
Chromosome 16 (position 18343408)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 16384645
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCACTGCTCTATAATGAACTGTGCTCTTGCTTTTAAAGGCAAACGCAGT[G/A]GGATCCTCCCAGCTGGGATGGGACGACAGAGGAAGCTAGTGTTGAACACG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link