nfs1

Ensembl ID:
ENSDARG00000062237
ZFIN ID:
ZDB-GENE-060405-1
Description:
cysteine desulfurase, mitochondrial [Source:RefSeq peptide;Acc:NP_001038458]
Human Orthologue:
NFS1
Human Description:
NFS1 nitrogen fixation 1 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:15910]
Mouse Orthologue:
Nfs1
Mouse Description:
nitrogen fixation gene 1 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1316706]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8913 Essential Splice Site Mutation detected in F1 DNA During 2017
sa30659 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa8913
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089747 Essential Splice Site 102 451 3 13
Genomic Location (Zv9):
Chromosome 11 (position 25283110)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 24111935
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATGCCTATGGATGGGAGAGCGAGAGCGCAATGGAAAAAGCAAGAAAAG[T/C]ATGTTWAGATGACTGCTTGTTTTATTTGAAAATRATAGTTTTCTTGATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30659
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089747 Essential Splice Site 401 451 11 13
Genomic Location (Zv9):
Chromosome 11 (position 25286768)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 24115593
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTCAGAGCAATAGGAGCAGATGAGGATTTGGCTCACTCTTCTATTCGG[T/C]TGGTGGTCTTCATGTAACATTAGTTTAAATGTTTATTGTGCCTTCATGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link