ndrg4

Ensembl ID:
ENSDARG00000062236
ZFIN ID:
ZDB-GENE-060512-226
Description:
N-myc downstream regulated gene 4 [Source:RefSeq peptide;Acc:NP_001038638]
Human Orthologue:
NDRG4
Human Description:
NDRG family member 4 [Source:HGNC Symbol;Acc:14466]
Mouse Orthologue:
Ndrg4
Mouse Description:
N-myc downstream regulated gene 4 Gene [Source:MGI Symbol;Acc:MGI:2384590]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44247 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44247
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089737 Essential Splice Site 156 371 6 14
ENSDART00000128808 Essential Splice Site 124 352 5 14
Genomic Location (Zv9):
Chromosome 25 (position 12598860)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 13255599
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTCGGAATTGGAGTTGGGGCTGGAGCCTACATCCTGGCCAAATTCGCG[G/A]TTAGTACATCTCCTCCTTTTACTTTACTATATTAGTTTATATTATTAATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link