lrrc34

Ensembl ID:
ENSDARG00000062235
ZFIN ID:
ZDB-GENE-091118-73
Description:
LOC556175 protein [Source:UniProtKB/TrEMBL;Acc:A3KP83]
Human Orthologue:
LRRC34
Human Description:
leucine rich repeat containing 34 [Source:HGNC Symbol;Acc:28408]
Mouse Orthologue:
Lrrc34
Mouse Description:
leucine rich repeat containing 34 Gene [Source:MGI Symbol;Acc:MGI:1919077]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24515 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24515
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089756 Essential Splice Site 297 410 8 10

The following transcripts of ENSDARG00000062235 do not overlap with this mutation:

Genomic Location:
Chromosome 24 (position 27147862)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATACATCTAAGTGAAGCTATCAAGCTGCCACATAGCAAACTCAAAGCG[T/A]TAGTGTCCTCTGCTAATCAAAGTCTAAAATCTTTTTTCTTCGTGCTGTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/34yejjqg