plekha7b

Ensembl ID:
ENSDARG00000062220
ZFIN ID:
ZDB-GENE-091014-2
Human Orthologue:
PLEKHA7
Human Description:
pleckstrin homology domain containing, family A member 7 [Source:HGNC Symbol;Acc:27049]
Mouse Orthologue:
Plekha7
Mouse Description:
pleckstrin homology domain containing, family A member 7 Gene [Source:MGI Symbol;Acc:MGI:2445094]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18677 Nonsense Available for shipment Available now
sa11681 Nonsense Available for shipment Available now
sa11132 Nonsense Available for shipment Available now
sa31573 Nonsense Available for shipment Available now
sa18155 Nonsense Available for shipment Available now
sa40897 Nonsense Mutation detected in F1 DNA During 2017
sa20950 Nonsense Available for shipment Available now
sa9044 Nonsense Mutation detected in F1 DNA During 2017
sa34078 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18677
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110605 Nonsense 188 1267 7 27
ENSDART00000110605 Nonsense 188 1267 7 27
Genomic Location (Zv9):
Chromosome 7 (position 28282325)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 26885264
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCTTAGGACAGCTCAGGCATGAGACTGTGGAAGAGGAAATGGTTTGTGT[T/A]GTCTGATTACTGCTTGTTTTATTATAAAGGTGAGTTATTGGATTCTACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11681
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110605 Nonsense 188 1267 7 27
ENSDART00000110605 Nonsense 188 1267 7 27
Genomic Location (Zv9):
Chromosome 7 (position 28282325)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 26885264
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCTTAGGACAGCTCAGGCATGAGACTGTGGAAGAGGAAATGGTTTGTGT[T/A]GTCTGATTACTGCTTGTTTTATTATAAAGGTGAGTTATTGGATTCTACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11132
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110605 Nonsense 300 1267 10 27
Genomic Location (Zv9):
Chromosome 7 (position 28305082)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 26908021
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAACTCWCTTTTWCTCCACAGAGAAGCTGAAAGAAGCTCCAAACCTGAG[C/T]AGCATGCCGTCCCACAGACCAACCATTTCAGCAGCAKCAAAGGCTCATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31573
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110605 Nonsense 802 1267 18 27
Genomic Location (Zv9):
Chromosome 7 (position 28332022)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 26934961
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAAACGTAAATCTGTGTTTGTGTGCAGCAGGAGAAATCTCAAATGAGG[A/T]AGGAACTGTGGCGGATCGAAGATGTGCTCGCAGGCCTGAGCTCAAGCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18155
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110605 Nonsense 821 1267 18 27
Genomic Location (Zv9):
Chromosome 7 (position 28332081)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 26935020
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGYGGATCGAAGATGTGCTCGCAGGCCTGAGCTCAAGCAAAGCAAACTA[C/A]AGAGTGAKCATTGACTCAGTGCGTAATCCAGGTGAGAGCGGCYCCCTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40897
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110605 Nonsense 892 1267 19 27
Genomic Location (Zv9):
Chromosome 7 (position 28332398)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 26935337
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCTGCTCAACCCAGCCCACATCTCAGCCCTGTGCAGCCATGTACCCAA[C/T]AGCCTCTGCAACTCTCGCACACAGCCCTCAAGCCAAAATGGGTAAGTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20950
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110605 Nonsense 987 1267 21 27
Genomic Location (Zv9):
Chromosome 7 (position 28334731)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 26937670
KASP Assay ID:
2259-8883.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGAGATACGGGCATTCCTCAGCGAGCCTGAACTGCTGGTGGTCGGTGGA[C/T]AGATTGGGAGCTTGAGCCGTGATAGTGGCTACCAAACTCTACCAAACAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9044
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110605 Nonsense 1015 1267 22 27
Genomic Location (Zv9):
Chromosome 7 (position 28336119)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 26939058
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTCCAATTCTGCTAGGTTTGACAAGCTCCTCTTCAAGACTGAACCAGT[C/G]ATCAAACATTTCATCATTTGTCACCCTCAGAAGAGGACTCACCACCACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34078
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110605 Nonsense 1077 1267 23 27
Genomic Location (Zv9):
Chromosome 7 (position 28338599)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 26941538
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAGCTGGAGAGGATGAAGCGCCACCAAAAGGCTCTGGTACGAGAGCGC[A/T]AGAGAACCCTCAGCCAGGGCGAGCGGCAGGCCTCCACGTCTCGCGCTTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link