narfl

Ensembl ID:
ENSDARG00000062216
ZFIN ID:
ZDB-GENE-070209-119
Description:
Cytosolic Fe-S cluster assembly factor narfl [Source:UniProtKB/Swiss-Prot;Acc:A2RRV9]
Human Orthologue:
NARFL
Human Description:
nuclear prelamin A recognition factor-like [Source:HGNC Symbol;Acc:14179]
Mouse Orthologue:
Narfl
Mouse Description:
nuclear prelamin A recognition factor-like Gene [Source:MGI Symbol;Acc:MGI:1914813]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6882 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6882
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089679 Nonsense 36 477 2 11
ENSDART00000128636   None 412 2 11
Genomic Location (Zv9):
Chromosome 3 (position 18579602)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 18607964
KASP Assay ID:
554-4934.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGAATCACAGGAATGTGTGAAACCTGTGAAAGTGGAAAAGAAACAGGGT[C/T]GATCTGTGGCGAAAATCCAGATAGAAGATGATGGCAGTTATTTTCAGGTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link