KIAA0182 (2 of 2)

Ensembl ID:
ENSDARG00000062199
Description:
KIAA0182 [Source:HGNC Symbol;Acc:28979]
Human Orthologues:
AC011317.1, KIAA0182
Human Description:
KIAA0182 [Source:HGNC Symbol;Acc:28979]
Mouse Orthologues:
Gm11027, Gse1
Mouse Descriptions:
genetic suppressor element 1 Gene [Source:MGI Symbol;Acc:MGI:1098275]
predicted gene 11027 Gene [Source:MGI Symbol;Acc:MGI:3779250]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24678 Nonsense Available for shipment Available now
sa5998 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa24678
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089652 Nonsense 52 1048 1 15
Genomic Location (Zv9):
Chromosome 25 (position 22761952)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 21941065
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGCTGCCAGCGGGAGTCCTGCATCTCAATCCGGCTTCGCAGCAGCCCTC[C/T]GAAAGTTGGCCAAACAGGCTGAAGAGCCCAGAGGTCAGTGTTGAGCTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5998
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089652 Nonsense 889 1048 13 15
Genomic Location (Zv9):
Chromosome 25 (position 22814025)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 21993138
KASP Assay ID:
554-3841.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGAATCTGCCATTTTATATCCCTGTATATTTCAGCAGGAGTGAATGAG[C/T]AGGTTGACCCCGYAGCACATCCTTCTCCAGGCCTYCAGAGGGCARYGAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link