PCM1

Ensembl ID:
ENSDARG00000062198
Description:
pericentriolar material 1 [Source:HGNC Symbol;Acc:8727]
Human Orthologue:
PCM1
Human Description:
pericentriolar material 1 [Source:HGNC Symbol;Acc:8727]
Mouse Orthologue:
Pcm1
Mouse Description:
pericentriolar material 1 Gene [Source:MGI Symbol;Acc:MGI:1277958]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19460 Essential Splice Site Available for shipment Available now
sa39576 Nonsense Mutation detected in F1 DNA During 2017
sa39577 Essential Splice Site Mutation detected in F1 DNA During 2017
sa6578 Essential Splice Site Mutation detected in F1 DNA During 2017
sa1869 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19460
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089654 Essential Splice Site 826 2038 15 39
Genomic Location (Zv9):
Chromosome 1 (position 15377864)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 15943032
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAATCTGCTGAAAGTTTTATTTGTTTTTTTTTCTATCATGTATTTTCA[G/A]TCATCTGTGAGCAGTAGTGCCAGTGGTCAAATGAGCAGGAAGATTCCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39576
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089654 Nonsense 1065 2038 18 39
Genomic Location (Zv9):
Chromosome 1 (position 15380504)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 15945672
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTCCAGAAACAACTCAACTTCAGCACTACCATGTGCCAAACTCTGCTT[C/T]AGGATCAGCAGGTGAGAGTGTACAAAAATGGATTTTGTCAACGTCTTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39577
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089654 Essential Splice Site 1347 2038 22 39
Genomic Location (Zv9):
Chromosome 1 (position 15382217)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 15947385
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCAATATGAAGAGCCGCCGGAAGAGAGGCAGGGGACAGAAGAACACTGG[T/C]GTGTCTGTATTTAAAGTTTGACTTGCATCATTATTGGTTTGATATACTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6578
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089654 Essential Splice Site 1614 2038 28 39
Genomic Location (Zv9):
Chromosome 1 (position 15386041)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 15951209
KASP Assay ID:
554-5409.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCTCTGCCATTGCTGCTGCCACCRYTGCCTCACCTCAAGGTACTCAAG[G/A]TACTGCYGCCATCACTGTCACAYTGCACATCAGACCCGACAGACACWTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1869
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089654 Nonsense 1870 2038 34 39
Genomic Location (Zv9):
Chromosome 1 (position 15391971)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 15957139
KASP Assay ID:
554-1860.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGAGGTGCAAACATCATTACAAGCCAGCATGGACAACACTTGTGAACAC[A/T]GAGAGGTGCTTTTACAGTGTACAGTAGATAGCAAATAAGSTGACACAGCT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link