FBXO31

Ensembl ID:
ENSDARG00000062195
Description:
F-box protein 31 [Source:HGNC Symbol;Acc:16510]
Human Orthologue:
FBXO31
Human Description:
F-box protein 31 [Source:HGNC Symbol;Acc:16510]
Mouse Orthologue:
Fbxo31
Mouse Description:
F-box protein 31 Gene [Source:MGI Symbol;Acc:MGI:1354708]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1009 Essential Splice Site Available for shipment Available now
sa11947 Essential Splice Site Available for shipment Available now
sa19363 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa1009
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089642 Essential Splice Site 190 542 3 9
Genomic Location:
Chromosome 25 (position 22548062)
KASP Assay ID:
554-0913.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCTGGCAGCCTGATATCGGGCCCTATGGAGGACTGCTGAATGTGGTGG[T/G]AAGATCACAAAACAATAACACAATTTAATTAGAATTTAAATRCAAGACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11947
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089642 Essential Splice Site 271 542 5 9
ENSDART00000089642 Essential Splice Site 271 542 5 9
Genomic Location:
Chromosome 25 (position 22537095)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAGTGCAACCAGACCGATCACCATCGAATGCCTGGAGGAAGGCAAGAGG[T/G]AAGAGAGCAGYGATGCYTGCACAGATTTTAANGGAATACTATGGCAGAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19363
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089642 Essential Splice Site 271 542 5 9
ENSDART00000089642 Essential Splice Site 271 542 5 9
Genomic Location:
Chromosome 25 (position 22537095)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGTGCAACCAGACCGATCACCATCGAATGCCTGGAGGAAGGCAAGAGG[T/G]AAGAGAGCAGTGATGCTTGCACAGATTTTAAGGAATACTATGGCAGAATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/shqou2xr