si:dkey-110k5.6

Ensembl ID:
ENSDARG00000062192
ZFIN ID:
ZDB-GENE-030131-3135
Description:
TBC1 domain family member 8B [Source:UniProtKB/Swiss-Prot;Acc:B0R0W9]
Human Orthologue:
TBC1D8B
Human Description:
TBC1 domain family, member 8B (with GRAM domain) [Source:HGNC Symbol;Acc:24715]
Mouse Orthologue:
Tbc1d8b
Mouse Description:
TBC1 domain family, member 8B Gene [Source:MGI Symbol;Acc:MGI:1918101]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa999 Nonsense Available for shipment Available now
sa20398 Nonsense Available for shipment Available now
sa38468 Nonsense Mutation detected in F1 DNA During 2017
sa15626 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa999
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089605 Nonsense 468 1125 9 20
ENSDART00000135153 Nonsense 468 1108 9 20
Genomic Location (Zv9):
Chromosome 5 (position 25329500)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 23156765
KASP Assay ID:
554-0903.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCGTGGAACTGGAATGTTTTGCACCAAAAAAACACGTGACCTCATTGTG[C/T]GAGGAGTTCCAGAGACTCTCAGAGGAGAACTGTGGATGCTCTTCTCAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20398
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089605 Nonsense 719 1125 13 20
ENSDART00000135153 Nonsense 719 1108 13 20
Genomic Location (Zv9):
Chromosome 5 (position 25323570)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 23150835
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCAGCAACTGTTCAGCAGGCATCTGCAACAGCCAATGACAAATCAATA[C/T]AAAAGGTTGACATCAGCGACCTCATCAAAGAAGCATATGAGGTAAAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38468
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089605 Nonsense 731 1125 13 20
ENSDART00000135153 Nonsense 731 1108 13 20
Genomic Location (Zv9):
Chromosome 5 (position 25323532)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 23150797
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACAAATCAATACAAAAGGTTGACATCAGCGACCTCATCAAAGAAGCATA[T/A]GAGGTAAAGCTGCACACTTCAATACACGACAGTGAACATTCAAATCTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15626
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089605 Essential Splice Site 905 1125 18 20
ENSDART00000135153 Essential Splice Site 888 1108 18 20
Genomic Location (Zv9):
Chromosome 5 (position 25317847)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 23145112
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAKGTAGACTCTRCAGAGGACGGAGTGATCAGAAAATGTCCAGAGAGAGG[T/G]GAAGTATTCATCTGTGTGCTCTAATCGTGTTATCTACATCATATCAAGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Pancreatitis: Common genetic variants in the CLDN2 and PRSS1-PRSS2 loci alter risk for alcohol-related and sporadic pancreatitis. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link