pde3b

Ensembl ID:
ENSDARG00000062190
Human Orthologue:
PDE3B
Human Description:
phosphodiesterase 3B, cGMP-inhibited [Source:HGNC Symbol;Acc:8779]
Mouse Orthologue:
Pde3b
Mouse Description:
phosphodiesterase 3B, cGMP-inhibited Gene [Source:MGI Symbol;Acc:MGI:1333863]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7066 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa7066
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089640 Essential Splice Site 584 1103 7 16
Genomic Location (Zv9):
Chromosome 7 (position 28841872)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 27444811
KASP Assay ID:
554-5418.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCGAAGGCCATCACACAACAGCCAATGAGATGCAGAGAACACGCTCAGG[T/A]AAAGTTCATAAGCTCTATGACAAACRGGATTTCAGTAGAGTCGCTCAAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link