trpc4

Ensembl ID:
ENSDARG00000062183
Human Orthologue:
TRPC4
Human Description:
transient receptor potential cation channel, subfamily C, member 4 [Source:HGNC Symbol;Acc:12336]
Mouse Orthologue:
Trpc4
Mouse Description:
transient receptor potential cation channel, subfamily C, member 4 Gene [Source:MGI Symbol;Acc:MGI:1

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42592 Nonsense Mutation detected in F1 DNA During 2016
sa42591 Nonsense Mutation detected in F1 DNA During 2016
sa22689 Nonsense Mutation detected in F1 DNA During 2016
sa32051 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa42592
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089604 Nonsense 107 863 1 10
Genomic Location (Zv9):
Chromosome 15 (position 33230337)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 32786214
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGCTTCAATGTGTATGTCGGTGATGCTCTTCTCCACGCCATCCGTAAA[G/T]AGGTGGTGGGAGCTGTGGAGCTCCTGTTGAACCATAAGAAGCCCAGCGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42591
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089604 Nonsense 134 863 2 10
Genomic Location (Zv9):
Chromosome 15 (position 33206038)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 32810513
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGGCAATCTTTTCCATTTTTCACCCAGGTGCCTCCCATCCTGCTGGAT[A/T]AGCAGTTTTCGGACTTCACTCCGGACATCACCCCCATCATCCTGGCTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22689
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089604 Nonsense 407 863 3 10
Genomic Location (Zv9):
Chromosome 15 (position 33186857)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 32829694
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATCCTGATCGCCAAGGTCCAAAGCCTACCACAGTGGAGTGGATGATCT[T/G]ACCCTGGGTTCTGGGTAAGGGTTTATGTGATTTATTGTCTATGATAATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32051
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089604 Nonsense 594 863 6 10
Genomic Location (Zv9):
Chromosome 15 (position 33183886)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 32832665
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTTGATTAGTCTTTACGTGACTAATGTCAAAGCTGACCACAAGTTCACT[G/T]AATTTGTGGGCGCCACCATGTTCGGCACCTATAACGTCATCTCTTTGGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link