A7MC17_DANRE

Ensembl ID:
ENSDARG00000062182
Description:
LOC100001772 protein [Source:UniProtKB/TrEMBL;Acc:A7MC17]
Human Orthologue:
SLC22A7
Human Description:
solute carrier family 22 (organic anion transporter), member 7 [Source:HGNC Symbol;Acc:10971]
Mouse Orthologue:
Slc22a7
Mouse Description:
solute carrier family 22 (organic anion transporter), member 7 Gene [Source:MGI Symbol;Acc:MGI:18595

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8561 Essential Splice Site Mutation detected in F1 DNA During 2014
sa16596 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa8561
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078873 Essential Splice Site 428 555 7 10
Genomic Location:
Chromosome 17 (position 21817762)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAACTATTTGCAGGAATCAGCCTCATGATTAACATATTCATACCCAAAGG[T/G]GAGTGTGGAAATGTTAATTCTACATTTCAAACCAACCGGTTTGCAGTGYA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16596
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078873 Essential Splice Site 464 555 9 10
Genomic Location:
Chromosome 17 (position 21814919)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTGTAATTGCACACTACACGCTAAATAAACACTTTGATTGGATCCKCT[A/T]GGCAAAATGGCATGGGCTATAATTCCTTCCTGGCTCGTCTGGGTGTTTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Urate levels: Genome-wide association analyses identify 18 new loci associated with serum urate concentrations. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qe4sv1gg