dcbld2

Ensembl ID:
ENSDARG00000062177
ZFIN ID:
ZDB-GENE-070112-1822
Description:
discoidin, CUB and LCCL domain containing 2 [Source:RefSeq peptide;Acc:NP_001073640]
Human Orthologue:
DCBLD2
Human Description:
discoidin, CUB and LCCL domain containing 2 [Source:HGNC Symbol;Acc:24627]
Mouse Orthologue:
Dcbld2
Mouse Description:
discoidin, CUB and LCCL domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1920629]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21503 Nonsense Available for shipment Available now
sa41444 Nonsense Mutation detected in F1 DNA During 2017
sa8562 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa21503
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089582   None 235 None 9
ENSDART00000113710 Nonsense 396 671 10 15
ENSDART00000139863 Nonsense 396 661 10 15
ENSDART00000140040   None 42 None 9
Genomic Location (Zv9):
Chromosome 9 (position 31055841)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 30211787
KASP Assay ID:
2260-1955.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAGGAGGTGCGAAACAACTTTATTCCTCCAATTGAGGCACGCTTTCTC[C/T]GAATATGTCCCTTACAGTGGCACCAGAGGATCGCCCTTAAAATGGAACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41444
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089582   None 235 None 9
ENSDART00000113710 Nonsense 452 671 11 15
ENSDART00000139863 Nonsense 452 661 11 15
ENSDART00000140040   None 42 None 9
Genomic Location (Zv9):
Chromosome 9 (position 31052656)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 30208602
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGCACAACACCGCCAGCGCAGGACAGGACCACACACACACCCAACATC[C/T]GAAACTCCACCATGCCTCCACACTCCCATGACGGTAAGATATTCTGCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8562
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089582   None 235 None 9
ENSDART00000113710 Essential Splice Site 462 671 11 15
ENSDART00000139863 Essential Splice Site 462 661 11 15
ENSDART00000140040   None 42 None 9
Genomic Location (Zv9):
Chromosome 9 (position 31052622)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 30208568
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACACACCCAACATCCGAAACTCCACCATGCCTCCACACTCCCATGACG[G/T]TAAGATATTCTGCATTCACTACAGCAACATTACATCACTACRAGCTCTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link