cacnb4b

Ensembl ID:
ENSDARG00000062174
ZFIN IDs:
ZDB-GENE-060421-7907, ZDB-GENE-060421-7907, ZDB-GENE-060421-7907, ZDB-GENE-060421-7907
Description:
calcium channel, voltage-dependent, beta 4b subunit isoform 1 [Source:RefSeq peptide;Acc:NP_0010354
Human Orthologue:
CACNB4
Human Description:
calcium channel, voltage-dependent, beta 4 subunit [Source:HGNC Symbol;Acc:1404]
Mouse Orthologue:
Cacnb4
Mouse Description:
calcium channel, voltage-dependent, beta 4 subunit Gene [Source:MGI Symbol;Acc:MGI:103301]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7033 Nonsense Mutation detected in F1 DNA During 2014
sa20670 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7033
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089564 Nonsense 140 523 5 14
ENSDART00000089577 Nonsense 106 489 4 13
ENSDART00000122023 Nonsense 140 184 5 13
ENSDART00000126438 Nonsense 106 150 4 5
Genomic Location:
Chromosome 6 (position 14032100)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCTAAAGTTTTATCCTTTYTTCTCCRTATGCAGAAGTTTAATAATGACT[G/A]GTGGAYTGGGAGGCTGGTAAAAGAAGGCTGYGAGATTGGCTTTATCCCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20670
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089564 Nonsense 226 523 8 14
ENSDART00000089577 Nonsense 192 489 7 13
ENSDART00000122023 None None 184 7 13
ENSDART00000126438 None None 150 None 5
Genomic Location:
Chromosome 6 (position 14015612)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCCTTCCATGAGGCCTGTGGTTCTGGTTGGTCCATCCCTGAAAGGATA[T/A]GAGGTATGTTGAGACCTATCATCGTTAGACTTGGGTACTTGTTGTTGACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/brm8uk2z