camsap1l1

Ensembl ID:
ENSDARG00000062173
ZFIN ID:
ZDB-GENE-030131-3016
Description:
calmodulin regulated spectrin-associated protein 1-like 1 [Source:RefSeq peptide;Acc:NP_001038461]
Human Orthologue:
CAMSAP1L1
Human Description:
calmodulin regulated spectrin-associated protein 1-like 1 [Source:HGNC Symbol;Acc:29188]
Mouse Orthologue:
Camsap1l1
Mouse Description:
calmodulin regulated spectrin-associated protein 1-like 1 Gene [Source:MGI Symbol;Acc:MGI:1922434]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6710 Nonsense Mutation detected in F1 DNA During 2014
sa15817 Nonsense Available for shipment Available now
sa1309 Nonsense Available for shipment Available now
sa24164 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6710
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089569 Nonsense 922 1410 11 17
ENSDART00000142947 Nonsense 919 1407 11 17
Genomic Location:
Chromosome 22 (position 22716076)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCCTAAGAAGATTCTCCCCATCTCAGCCCATGTCCTGCTCATTTTCWTA[T/A]ATGGGAAACGAGAAGAAACCATTATCAACAGCTGACAAAGACATTGAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15817
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089569 Nonsense 1078 1410 11 17
ENSDART00000142947 Nonsense 1075 1407 11 17
Genomic Location:
Chromosome 22 (position 22715610)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAGGAGGCCTCTGGGGAAAATCARGATGAYGATCAGAAAGCGTGYTGT[G/T]GATTCTTCTTCAAGGTARAGAATAATCCTGTAGATAAATCTTMTGATTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1309
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089569 Nonsense 1122 1410 12 17
ENSDART00000142947 Nonsense 1119 1407 12 17
Genomic Location:
Chromosome 22 (position 22714479)
KASP Assay ID:
554-1224.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGAACGGGAAAGCCAGCAGAGAAAACAGCAGCTGGAGGCWGAGCATGAG[C/T]AGAAGAAAGAGGAGGCTAGGTAAGAGCCAGCTCAGCTGTCAATCAAAGAG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa24164
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089569 Essential Splice Site 1232 1410 14 17
ENSDART00000142947 Essential Splice Site 1229 1407 14 17
Genomic Location:
Chromosome 22 (position 22712740)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTCTCTTGGAGATAATGACAGCGTCAACTCCGATAAGAAAACACCCAG[G/A]TAAGAGCCAGTTAGGCAAAAAGAATATTTATTTCCTGTTTCCCAGCAATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Epilepsy: Two-stage genome-wide association study identifies variants in CAMSAP1L1 as susceptibility loci for epilepsy in Chinese. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/72w0oroy