LOC558640

Ensembl ID:
ENSDARG00000062168
Human Orthologue:
TMEM168
Human Description:
transmembrane protein 168 [Source:HGNC Symbol;Acc:25826]
Mouse Orthologue:
Tmem168
Mouse Description:
transmembrane protein 168 Gene [Source:MGI Symbol;Acc:MGI:1921794]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5104 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa5104
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089596 Nonsense 377 699 1 4
Genomic Location:
Chromosome 25 (position 22432539)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGTGCTCTTCAGCCTGGTGTCCACAGTCATACTCGGAGCTCTGGGTTG[G/A]CAGGTAAAAATAGTTTCCGTGAAAATCATTCAAAAATGTATTAATATGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/446gijws